Microarray Probes on PGSC0003DMT400073644

Probe IDChipProbe Sequence
CUST_40825_PI426222305 JHI_St_60k_v1 TGCCTAAATCCGTTTTCTCTGTTATATTAGGCTCTTCCAAGGTTGACAAACAGAGAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073644

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400073644 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G54820.1 +3 4e-24 99 54/103 (52%) Protein kinase superfamily protein | chr1:20447370-20450761 FORWARD LENGTH=458

Transcript Sequence (636 bp)

>PGSC0003DMT400073644 636 pgsc_dm_v3.4
CAATAGCGAAACTATTACCCCATACAATACAAGATTCGGGCGTTTGATTGAAACAATGCC
TAAATCCGTTTTCTCTGTTATATTAGGCTCTTCCAAGGTTGACAAACAGAGAAAAAGTAG
TTGAAATGGTTGATCCAACATTACAAGGGCAGTACACGAAGAAGGATCTAATCCAGGTAA
ATGTCATAACATTTATCCTCATACTACATATGAAACCAAATGTAATGTTTTTTTTGCTAA
AACAGGTAGCTGCTATAGCAGCAATGTGTGTTCAAACAGAAGCAGATTATCGTCCGTTAA
TGACAGATGTTGTGCAATCCTTAGTACCTCTTGTCAAGACATACTCTTCTTCATGCCCTG
CCAATTCCTTCAGATCATATAACCAGACCGTGAGTCCAAGGTCTTAGGAGGAGCCATTAA
TTCGGAATCTGAAGACGTTTCCAACATTATTCGTGATTCAACATTTCCATAAAAGTTATT
TGATCAAATGTTGGAGAATGACAACATGTAACAAATATCTGGTTAAAGCAATAAGGCTTA
TGTATTATAGTATTCAACTCTAATAAACCATTTTAATTAGTAATGCTTCATCGTCTAGTG
AATGATAATAAACACGATAATTATAATATAATTCAG