Microarray Probes on PGSC0003DMT400073464

Probe IDChipProbe Sequence
CUST_31474_PI426222305 JHI_St_60k_v1 TATCAATTGCAGAGCTTGAACTAACCAACAATAATCAAAAATCTCCACGCCAAAACCCTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073464

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400073464 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G52565.1 +2 4e-13 64 40/92 (43%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15760.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | chr1:19580061-19580511 REVERSE LENGTH=129

Transcript Sequence (546 bp)

>PGSC0003DMT400073464 546 pgsc_dm_v3.4
CAAGCATATCCAGATTCCCCTGCTGTCTCTCTGACGGCAACAACAACAAGTAGTGTGCGT
GTATGAATTGCTATACAAATTCTCTCTTTTTGTGTTTCTTCTGATCAATTTCATCAATTC
AAATCTGCTATTAATTATTATGTGTTGTTTGATGGGCTCACAAGGCGTTGTGTTGGCAAC
AGCTGTGGTTGTTTCTGCGGGCACTATTGTTGTGTTTGATCTTCTTCGCCAAAAGTATTT
ATCAATTGCAGAGCTTGAACTAACCAACAATAATCAAAAATCTCCACGCCAAAACCCTCT
TCTCAAGTCTTGCTTATCTTCAGGTGAAAAGAACATGAATTCGAGGAGGAAGAAGAAAAG
GGTTCATTTTGCAGCAGATGTGAAAGATTCTAATAGTAATGGCGAGGAGTACAGAAGAGG
GGGTAGAAATACAAGAAATTTTAGTATCCTCCCAATTTGGTTGTAAATCGTGATGTATGA
AAAAGTACTTCAGAATATTTTGTATGTCTAGATTCAATTGTTTTCTAAATTTAACTTCTT
TCTTAC