Microarray Probes on PGSC0003DMT400073357

Probe IDChipProbe Sequence
CUST_31460_PI426222305 JHI_St_60k_v1 TGAAGCATTGTGGATTGTATGGAAGTTTTCAGCAAAGGCATACATCGAGCCATGGTACCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073357

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400073357 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G15330.1 +3 2e-67 217 116/221 (52%) Cystathionine beta-synthase (CBS) protein | chr1:5274368-5275499 FORWARD LENGTH=352

Transcript Sequence (875 bp)

>PGSC0003DMT400073357 875 pgsc_dm_v3.4
CAAATGTATCTTACGAATTGCTGGTTTATATGTGAAGCATTGTGGATTGTATGGAAGTTT
TCAGCAAAGGCATACATCGAGCCATGGTACCAGTGAATGGACGATCAGAAAATGTAGTTG
GTGTTGAGCTTACTGAGTCTGCATCATGTTACCGAATGCTAACACAAATGGATCTGCTTA
GGTTTTTGAATGACCAGCAGGAGCTTAAAGCTATCATGTCGCACAAGGTCTCGGATAAAC
AACTGCAAGCAATCACAGACACTGTTTTCGGTGTGACTAATAAGGCTAAAGTTATCGATG
TGATCAAATGCATGAGAACAGCTTCGCTAAATGCAGTACCAATTGTGGAGTCATCTAATG
AAATAACAGAAGATCATACTCAGCTTGTAAATGGGAAAAAGAGGAAGATTGTAGGAACAT
TTTCAGCAACGGACTTGAGAGGATGTCCTGTATCGAAAATGCAGCCTCTACTGAATCTAG
AGGTCCTTGATTTCTTGAAAATGCTGTCTAATACCGGGATGAGATCTTCATGGAGGGAAC
AAGTGACATGCCATCCAGAATCGTCACTCGGGGAAGTGGTGGAGAAAGTTGTTTCAGACA
ATGTGCATCGTGTTTGGGTGGTGGATGAACAAGGCTTGCTGGAAGGACTTGTATCCCTAA
CTGACATGATAAGAGTCATCAGGCTCTGGTATCTTACTGAGTTTTTGCAGTAATGTGTAG
TTGTTGTACACACACACTGTTTTGCACCCGTTTTGTTCTGGTTGCTGTTTTGGTGTAAAT
GAAATGCAATCTGTTTATCAAATGATATGATCATTTCGCTCAAAAATTTGTCTACAAGTA
AAATTGAAGAAAAAAGATGGTAAGAGATAATATTG