Microarray Probes on PGSC0003DMT400073345

Probe IDChipProbe Sequence
CUST_31483_PI426222305 JHI_St_60k_v1 GAACGCGAACAAGAGTTGGAGAAACTTGGATCAGCTCTATCTTCTTGGGGATGTTTTCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073345

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400073345 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G49390.1 +2 3e-99 322 151/288 (52%) 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein | chr1:18279600-18280873 FORWARD LENGTH=348

Transcript Sequence (3844 bp)

>PGSC0003DMT400073345 3844 pgsc_dm_v3.4
AAATTTTAAAAGTGTCTAGATTATCATTTTGTAAGTTGGAGTGTTCAACAGACAGAGTGG
AGACAAGTTGAGGTATCTAGATGTCCACTCTCAAAGTTGGATGCTTACTTGCCAACTAAG
GCCAAATTAAGTGTCTGTATTATGCCTACATATAATGCTATCACTCTGGAACCTGAACTT
CTAATTGGAAACCCATTGGATAGTGTTACTTGATCATAGCATAAGCATGGCTGCATATTC
AGTTCCACCTGTAGAGGAGTTGCTGTCAAAAAGAGTTCAAGAAATGGTCCTTCATGGGGA
GGAGCCACTAGGACCTTATATTTGCAGAAGTGGTGACGATGTTGATGAAAAAGAAGACAT
CATGGATACTTCTCCAATTCCTATAATTGATCTAAACCTCCTGTCTTCTTCAACAACATC
AGATAACGAACGCGAACAAGAGTTGGAGAAACTTGGATCAGCTCTATCTTCTTGGGGATG
TTTTCAGGGAATAGCACATGGGATTTCAGCTTCTTTACTGGACAAAATCCGCCAAGTTTC
AAGGGAATTCTTCAACCAGCCAATGGAAGAGAAGAACAGGTATGCTAAATCAGTTGTTGA
TTTCCAAGGTTATGGAGCTGATCCTGTTCCAGAACAAGGTCAGTCCCTTGATTGGTCTGA
TCGTCTCTTCCTCGAGGTGTTCCCTGAAGATGGAAGACAGTATAACCTCTGGCCACAAAT
CCCAATATCATTCAGAGAGGTCTTAGAAGATTATTCTGAGAAAATGAAAATGGTCACAGA
AATTACCTCTAAAGCTATGGCAAAGTCGTTGAAGCTGGAAGAAAAGTGCTTCTTGGAACA
ATTTGGAAAACAAGCACAACTGCATGCGCGGTTTAACTACTACTCGCCATGTCAGAGGCC
TGATCTGGTTCTTGGCTTAAAACCCCATGCTGATGGAACAGGATACACTATTATTCTGCA
AGATGAAGTAGGACTCCAAGTGCTTAAGGATGGCAAATGGTATACAGTACCAAAAAATCC
TACAGCTCTGCTTGTTCTCATGGGTGATCAAATGGAGATAATGAGCAATGGAATATTCAA
GAGCCCGGTGCATAGGGTAGTGAGTAATTCAGAGAGGGATAGAATTTCTATCGCAATGTT
CTACACGCCTGAATTAGGGAAAGAAATCGGACCAGAAGATGACTTAGTCAATATGGACAG
ACCAAGGATATACAAGAAAGTGACAGATTATGCAGAAACTCATTGGAAGTTTTACCAGCG
TGGTATGAGAGCACTACACACTGCACACATTTAGAACTACTATCTATCTATATATGTCTT
CCTCATGTTGTTTGGGCATGGATAGAAAGTCTACAACTCCAATTTTGGCTTTACATTTTT
TTCACCTCAGGTTCGGAAGAAGAAGGCACCATTCTAATAAATGAATCATCCAATGATGAT
TTGGTCTGCAAATTGGAACTCTTTTATTTGAGCTCATTCTCTTAATTTCCTTCAAGCATT
CCAATATTAAGTTAGACAAGGATTCAGCAATAGAAAAAATGAACTAAAAAGGCATTGCAT
AAAATTTGCTGCATACACGTTTAAAGTCTAAAATATCAAATCCATGAGGCCTTTGAAGAT
AAATATTTGCAGACGTGTGCACAATAAGCACATTTAAAGGAAAAATCACAGTAGTAGCCC
AGAAATTGTGACTTATTTCAATTGATGTAACAGGTCCATGACGATTGACGACTGTCATAT
CATATGGCAGGACAAAAAAGTAGAATAAGTCAACAAATATTCTTCTTTGAACTTCTGCCC
ATAAATAGATACTATTTGATATTTCAAAAACTTTAGGCCACTCGCAACTGTACAAGACGA
ATTCACCATTAAATATTTATAGATATATAGTTTACTTTTTAATTATTAGTATACATTTTT
GGCTACAATTCCTTTTCCTCACAAGTATCTCTTCCCAAGGGAAAATACAAGTATGAGAAG
TTTTGGATGAACATGGCTGCAAGTCTGCAGGCGCCTCCACATGTAGGGACAATTGCATTT
GTCTTTGCTAGCTGTGTGGACCTCATCTTACGTTCAATCCTTATCTTCTGTTAAGAAACA
CACACACACACACATATATACTGTATAATACATATAAGTAAACACTTTAACTTGAGAGCA
CATGTTTAGACATCTTAACTTGATTTCAAGTCTCAACTGACAACTAAACACTCCAATTTG
TTTTCATTGTGTCTCGTGGACATCCACACTGATGTGACATATGAATCCGTGTCTAAATGA
TCATTTGTAAGTTAGAGTGTTCGACTGACATAGTGAAGGCGAGTTGAGGTGTCTGGTCTC
AAAGTTGGAGTGCTTAGTTACTTGCCAGCTAAGGTCAAAGTTGAACTGTTGTTTATGTAT
TATGCCTACTATGTATAAATGCTATCACCCTGGAACCTGAAGTCTAATTCATTAACTTCT
TATTGGAAACCAACTGGATAGTGTAACTTGATCATAGAATTAGCATGGCTGCATATTCAG
TTCCACCCTCAGAGGTGTTGCTGTCAAAAAGAGTTCAAGAAATGGTCCTTCATGGGGAGG
AGCCACTAGGACCTTATATTTGCAGAAGTGGTGAAGATGTTGATGGAAAAGAAGACATCA
TGGATACTTCTCCAATTCCTATAATTGATCTAAACCTCCTATCTTCTTCAACAACATCAG
ATAACGAACGCGAACAAGAGTTGGAGAAACTTAGATCAGCTCTATCTTCTTGGGGATGTT
TTCAGGGAATAGGACATGGGATTAAAACTTCTTTCCTGGACAAAATCCGCCAAGTTTCAA
GGGAATTCTTCAAACAGCCAATGGAAGAGAAGAACAAGTATGCTAAATCAGTTGATGATT
TTCAAGGTTATGGAGCTGATCCTGTTCCGGAACAAGGTCAGTCTCTTGATTGGTCTGATC
GTCTCTTCCTCGAGGTATTCCCTGAAGATAGAAGAGAGTATAACCTCTGGCCACAAATCC
CAATATCATTCAGAGAGGTCTTAGAAGATTATTCTGAGAAAATGAAAATGGTCACAGAAA
TTACCTCTAAAGCTATGGCAAAGTCACTGAAACTGGAAGAAAATTGCTTCTTGGAACAAT
TGGAAAACAAGCACAATTTCATGCGCGGTTTAACTACTACTTGCCATGTCAGAGGCCTGA
TCTGGTTCTTGGCTTAAAACCCCATGCTGATGGAACAGGATACACTATTATTTTGCAAGA
TGAAGTAGGACTCCAAGTGCTTAAGGATGGCAAATGGTATACAGTACCAAAAGATCCTAC
AGCTCTGTTTGTTCTCATGGGTGATCAAATGGAGGTAATGAGCAATGGAATATTCAAGGG
CCTGGTGCATATGGTAGTGAGTAATTCAGAGAGGGATAGAATTTCTGTCGCAATGTTCTA
CACACCTGAATTAGGGAAAGAAATCGGACCAGAAGATGACTTAGTAAATATGGACAGACC
AAGGATATACAAGAAAGTGACAGATTATGCAGAAACTCACTGGAAGTTTTACCAGCGTGG
TTTGAGAGCACTACACACTGCACACATTTAGTACTACTATATATGTCTTCCACTGTTTTC
TTTATGCTGTAGCGCGAAGAAGTTTTGGAGAGAGGTGATGAGATGCAGGTTCAGGTTACC
GAGTAGATGACCCTAGATAGTAGGGTGTGGAGGACACGTATTAGAGTAGAAGAGTAGTAG
GTAGTATAGTATTGTCTTGTTTAGGGTGGCTAGTGTTTGTGATGGTACTAGTTGTTTATT
TTTTTAATAATATATCCTAGTATATTGTTTATGATATTTCAATTATCACGTGATTTTATT
GTTG