Microarray Probes on PGSC0003DMT400073290

Probe IDChipProbe Sequence
CUST_34911_PI426222305 JHI_St_60k_v1 GGAGAAAGGGGTAACTGGAGATACCTTGAATTTTCTTGTTTTTGATTGATTAGAGTATTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073290

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400073290 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G45820.1 +3 4e-168 369 192/311 (62%) CBL-interacting protein kinase 20 | chr5:18587081-18588400 REVERSE LENGTH=439

Transcript Sequence (1992 bp)

>PGSC0003DMT400073290 1992 pgsc_dm_v3.4
CAATGAGATGTAGTGCATTTATTGCCATAAATTTTCTCCATACTAATTGAGAGTACTTTC
TCCTATAGGCATTTCCTCTAACCCTGCCCACAAATAAGGCAAGGTTTTTGGCCTTTTTTC
TCCCCTTCAATTTGTCTCCTCCATATCAATATTCCAAATCTTTCAACAAAACAAAAAGGG
CTCCTTAATCTCCGTACAACAACGACAATAACAACTATGCCTCTGTTCCAAACAGATTAC
GATAGCCTTTGTTAAGCCACAATGACAATGATTCCTCAACAATATTAACAAAATTGTCTC
AATTGTATTGCCAATTTCTTCATCATGATGACTACTAAGAATGAGAAGAAAGGCAATATT
TTGATGCAAAGGTATGAGATTGGGAAATTGCTTGGGCAGGGCACATTTGCCAAAGTATAC
CATGCTAGAAATCTCAAAACAGGGCAGAGTGTTGCTATTAAGGTGATTGACAAAGAGAAG
ATTATGAAGGTTGGGTTAATTGATCAAACCAAACGTGAAATCTCCGTCATGAGGCTAATC
AAACACCCAAATATTGTCCAGCTCTATGAGGTTATGGCTAGCAAAACAAAAATATACTTT
GCTATGGAATATGTTAGAGGTGGTGAACTTTTCAATAAGGTTGCTAAAGGCAGACTTAAA
GAAGATGCTGCAAGAAAATACTTTCAACAATTAATCGCTGCAGTCGATTTTTGTCATAGC
CGTGATGTCTATCACCGTGATCTCAAGCCTGAAAATCTCCTCCTTGACGAAGGTAGTATT
AAAATTTTGATAAGAGTCGTGAGAGAAGCACATTTTTATTTACTTAGTTATGTCTTGGTG
CAACAGGTGGCAACCTGAAAGTCTCGGATTTTGGTCTGAGTGCATTGTTCGATTCGAAAA
GGCAAGATGGTCTCCTCCACACAACGTGTGGAACACCGGCTTATGTTGCACCAGAGGTGA
TCAACAAGAGAGGTTATGATGGTGAAAAGGCTGATATTTGGTCATGTGGTGTTGTTTTAT
TTGTCCTGTTAGCAGGTTATTTGCCATTCCATGACCAAAATCTTATGGAAATGTACAAAA
AAATAAGCAAAGCAGAATTCAAATGTCCACAATGGTTCCATCCAGAGGTAAGAAAGCTAC
TCTCAAGGATTCTTGATCCAAATCCAGGATCAAGAATCACCTTAATTAAGCTCATGGATA
ATTCTTGGTTCAAAAAAGGATTCAAACAAATTGATAAAACCCCAAATCCAGGGAAAGATC
AACGTGAATCCCCTCGTAGTGTTTTCGATATTGAGGACAATAATTCAGATGGAGAGGGAC
CTTCCAATCCCCAAAAAAATCAAGATTCCACAACAATGAAGCCTACTTGCTTAAATGCAT
TTGATATCATTTCTCTTTCCCCTGGTTTCGATCTTTCTGGATTATTCGAAAAGGAGAAAG
AGAGAAGATCAGAAGCGCGATTCACAGCGAAAAAACCAGCTTCTATAATAGTATCAAAAT
TGGAAGAAGTAGCATCAAATGAGAGTTTTAATATAATGAAAAAAGATGGGACAGTAACAA
TGCAGAGTATTAAAGAAGGAAGAAAAGGGCAACTAGCAATTGATGCAGAGATATTCGAAA
TTACGCCTTCTTTTCATGTTGTGGAAGTGAGTAAAAAATCAGGGGATACAATGGAATACA
AGAAATTCTTTGATCAGGGATTGAAAACTTCACTTAAAGATATTGTTTGGACATGGCAAG
ATGGTGAGCAACAAGTTGAAAATCAAGAAAGAATTTGATCATCTTTTTTGTTTGTTATTA
TAATGAAAATTTTCATTTCTTTCTTGTTTGTATTTATATTTTGTTTTGTTTTTGTTTTGT
TTTGGGAAGGAGGAGAAAGGGGTAACTGGAGATACCTTGAATTTTCTTGTTTTTGATTGA
TTAGAGTATTGTATATTGTACAGGTCTAATAGATCTCAATTGAATTCAAGTAAAAAAAAT
ATGATGATGAAG