Microarray Probes on PGSC0003DMT400073070

Probe IDChipProbe Sequence
CUST_34871_PI426222305 JHI_St_60k_v1 TTAGGCAGCTTGTGTTTTGCCTTTCGGTTTGTTGTCATGTTATTATTTATGCCATCGATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073070

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400073070 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G34250.1 +3 0.0 860 430/474 (91%) SecY protein transport family protein | chr2:14462635-14464572 FORWARD LENGTH=475

Transcript Sequence (1971 bp)

>PGSC0003DMT400073070 1971 pgsc_dm_v3.4
CCCACTTGGCGTCACGCGTTCTCCATCTCTGTTAACTGGTGACGCTTACACATAAATCCG
TCAGATCCGCCCCTTCTCTCCCTATCCTCTCTCTCATGGTCAAAACCCTACAAATAGAAG
CATAGCTCGACGGAGAAATCGAGCGAATAACAGTCCACGGACATCTCCAGATCGTCGCTG
CTTCTAGATAATTCTGTTAATAGTGAACAATGGGAGGAGGATTCAGAGTGCTGCACCTTG
TGAAACCATTTCTCTCATTCCTACCTGAAGTTCAGAGTGCTGACAGGAAGGTTCAATTCA
AAGAGAAGGTCATCTATACTGTAATTGCTCTTGCTATTTTTCTGGTTTGCAGTCAGCTCC
CTCTTTATGGCATACACTCTACAACTGGCGCGGATCCTTTTTACTGGATGCGTGTCATTC
TTGCCTCAAACCGTGGTACAGTCATGGAACTTGGAATTACTCCAATTGTGACTTCTGGAA
TGGTGATGCAATTGTTAGCTGGATCAAAAATCATTCAAGTGGACAACAATGTCCGTGAGG
ACCGAGCACTCCTTAATGGTGCTCAAAAGCTATTGGGTATCCTGATTGCTGTCGGTGAGG
CAGTTGCTTATGTCCTGTCGGGGATGTATGGCAGTGTTAGCCAATTGGGTGTTGGAAATG
CTATCCTCATTATCCTCCAACTCTGCTTTGCTGCTATCATTGTCATGTGCTTAGATGAAC
TTCTTCAGAAAGGATATGGTCTTGGCTCTGGAATTTCCTTGTTCATAGCTACCAATATCT
GTGAAAGCATTATCTGGAAAGCATTCAGTCCCACAACCATCAATACCGGGCGTGGTGCTG
AATTTGAAGGAGCTATAATTGCTCTGTTCCATCTTACTATTAGTAGATCAAATAAGATTA
GTGCCCTGCGCGAGGCTTTCTACCGGCAAAGTCTCCCCAATGTGACAAATCTGCTTGCAA
CTGTGTTGATCTTCCTCATTGTTATCTACTTTCAAGGATTCCGTGTAGTTTTACCTGTTA
GATCTAAGAATGCTCGCGGACAGCAAGGTTCTTACCCAATCAAACTCTTCTACACCTCAA
ACATGCCTATTATTCTGCAGTCTGCACTTGTCTCCAACCTGTATTTCATCTCTCAGTTGC
TCTACAGGAGATATGGAGGAAATTTCATCGTGGATATGATAGGAACTTGGAAAGAATCTG
AATATTCTGGACAATCTGTTCCTGTTGCTGGTCTTGCTTACCTTGTCACTGCGCCGTCAA
GCTTGGCAGACATGGTGTCACATCCGTTCCACGCTCTTTTCTATATAGTGTTCATGTTAT
CAGCCTGTGCCCTGTTCTCAAAGACCTGGATTGAAGTTTCTGGATCATCTGCCAGAGATG
TTGCCAAGCAGCTTAAGGAGCAACAAATGGTGATGCCTGGTCATCGTGATTCCAACCTGC
AGAAGGAATTAAATCGTTACATACCTACTGCAGCTGCCTTTGGAGGAGTTTGCATTGGTG
CATTGACAGTTTTGGCAGACTTGATGGGAGCGATTGGATCAGGAACTGGAATCCTTCTTG
CAGTCACAATCATTTACCAGTATTTTGAGACATTCGAGAAGGAGAAGGCCACTGAACTAG
GCATGTTTGGTTTGTAGGCTGTAGCGTTTATGCTAGTTTGTCCCTCCTTCAAGCCAAGAG
AGCAATGTAACTGTTAACTTGTTGGCTTATAATGGATAGATATTAGAGGCCACGAGTTTT
TCCTGTTAAATTTTGTAAGTTTTTGTTGTTTTTAACTGTGCTGATGAGCGCCTGAATGTT
TTACAAGACAAGACTAGGTTAATTTACAGAAATTCTCAAAGGATGTTACTTGACCTCTCT
CCTGATTCCCCTCCATAATGTGATTGATACAAGCATTGAGCACAAACAAGCTTAGGCAGC
TTGTGTTTTGCCTTTCGGTTTGTTGTCATGTTATTATTTATGCCATCGATT