Microarray Probes on PGSC0003DMT400072921

Probe IDChipProbe Sequence
CUST_19416_PI426222305 JHI_St_60k_v1 TAAGCAGCCTACCTTGATGCAATTGTTAAAGACAGAATCCATGGCTCAAACCCGTGAGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400072921

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400072921 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G60980.2 +1 4e-31 126 101/320 (32%) Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain | chr5:24543988-24546027 FORWARD LENGTH=460

Transcript Sequence (1899 bp)

>PGSC0003DMT400072921 1899 pgsc_dm_v3.4
ATGGCTACTAAATCAACAAGACATGCTGCTGACAAAGTTGCCACTGCTTTTGTGGTTCAA
TACTATAACATTTTACAAACCCTAATCGACCAATCGTATCGATTTTACAAGGAAAAAAGT
GTTCTAAGTTGGCCATCGTCCGATGGTGAAACTAAGTCTGTGACAACTTCTGATGGCATA
AGTGATTTTATCATGTCATCACACTTTAAGGGTAGCAAAGTTGAAGTCAAAACTATTGAC
TCTCAATTATCTGTTGCTGGTGGTGTTTTGGTGATAGTTATGGCTTATTTAATTGGGCAA
GACAAGTCAAGAAAAGGGTTTTCTCAAACTTTTTTTCTTGCTCCACAAGAGACAGGATAC
TATGTGTTTAATGATATTTTTAGATTTATTGGTGAAGACAAATCTTCAACAATTGTTGAG
GAAAATGGTTCAATTGCTACTCCTTTAGCTACTCAGAGCAAAGCTGAAAACAATGTTGAT
GATGAAGTCGACCAGAAGCCTTCAAGCCCAAAAGAAGAAGAACAAAAAAAGAAGGCCCCT
GTGGCCCCCGTCATCGTTGAGAACGAGGCTCCAAAAATTACCTATGCTTCAATGATAAAG
CAAGGTAGGTCCTCGCCACCAAAAAATGTTGGCCTACCATCGGCTCCTAAAAAGCCGCAA
CCCAATAACTTCGTTCAGAAGTCTAGTTCGGGTGATGTGTTGAAAGTTGCAAGTACTCCT
TCAACCAGAGACGTTGCGCAAGACAATTATCATAATGACATCGAATATAAGTCGATATTT
GTTGGAGGATTACTACCCAACACAACAAAAAATGATTTATATGCTGTTGTTAAAGAGTTT
GGACCCCTTCACATTCAAGACGTTCAACTAAAAGCTTATGAAGTATACGAGACTCATCAC
ATTATGGTGAAGGGGAAACGAGCTTACATGAGATACAAGAGAACTAACAAAGGGCTACCA
AATGGAATGACTCTATTCTATATGGGAATTGTTAGTGGCATGATGTCTGCTGTTATTGCA
AACAGAAAAGAGATAGAAAAGGTTAATGAGAAGTTTAAATGGACCAAGAGTTTAGTACAA
GAGTTAGAAGAGGAGCTCAATGTGAAAGAGATTGCTAATGATGATTATGAAGATCCAAAT
CTATATAGTCTCTCTATGTCAACTGTTGATGAACCAACAAGACAAACCAGTGAAGCAGAA
AAACACGAGTCGATGAGCGAAATTGAGGCAGAGCTTGAAGCTGAATTGGAAAGGTTGGAA
ATGAGCTTGAAGGTTTCAACCTTTGAAAGAATATCTGATTTTGTTGAGCTAGATCCAGAA
GATGAAATAAATGTGGTTCAAGGAGACTTAAAACTAGATTGCCTCAGTGTACAGAGTCCT
GATTCATCAGAATCAGATAGTCATACTAATGGAACTTGGATTGTTCATTCTAAACCTGCC
AACTATCCTGTTTCCCCGAGGGAGCTTAGCTCGCGTCTGCATGAGGTAATAGAATCCAGA
CTAGAAGCTCGAATTAAGGAGCTCGAAACAGACCTTTATCATAGCCAAAATAGAGTTTGT
TCATTGGAAACACAGCATAATCTCTCTCAAAAGGACTTTGCATCGCGGGAATCAGAGTCA
TCTGAATGTCTACAAAGTTCATATTGGTATCATGAGGCTGATGAAGAGACCATCAGGATC
ATGCATGGAAGTGAAAATGCTTTTGACACTAATACAAGAATCCCTCCTTTTGATGGAGGA
TTGATTGATAGCCCAAACGAAAAAAAGGGTGGCCTGGTGCACGAACGTAAGCAGCCTACC
TTGATGCAATTGTTAAAGACAGAATCCATGGCTCAAACCCGTGAGCTGCAGGTCACACGG
AAACAACATTACCATTGCTCCAAGGTTCCCATTCATTGA