Microarray Probes on PGSC0003DMT400072782

Probe IDChipProbe Sequence
CUST_19442_PI426222305 JHI_St_60k_v1 ACATATGTCTTGTTGTGCAACAAAAGTGCAGCATTTGACAAAGTTCAAAGGTAGTTTACC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400072782

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400072782 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G13820.1 +2 3e-138 403 193/273 (71%) alpha/beta-Hydrolases superfamily protein | chr1:4735622-4737617 FORWARD LENGTH=339

Transcript Sequence (1273 bp)

>PGSC0003DMT400072782 1273 pgsc_dm_v3.4
TTCACGAATTGAGAGAATACCAGTAAACTTATTGAAGGGATGCGTCATGAGTAGTTGTGT
GAAGCCAAAAGAACAGACAGAGGCCAATCCAGTTGTGCTTCTCCATGGATTTGATAGCTC
ATGTTTAGAGTGGAGGTACACTCTTCCGATGCTTGAGGATGCTGGATTGGAGACATGGGC
AATTGATATCCTTGGATGGGGTTTCTCTGATTTAGGAAGGCTTCCATCGTGTGATGTAGC
TTCCAAGCGTGATCATCTTTACCAGCTGTGGTCTACCCACATCAAGAGGCCAATGGTACT
TGTTGGACCTAGTCTTGGATCTGCTGTTGCTATTGACTTTTCTGTTAAATATCCAGAAGC
TGTTGATAGGCTGGTTTTAATTGATGCAAGTGTTTACGCGGAAGGTACAGGAAACCTTGC
AACCTTACCCAAAGCAGTAGCCTATGCTGGGGTTTACTTGTTGAAAAGTCTCCCACTTCG
CTTATATGCAACTTCATTAGCTTTCAATGGCTTACCATTTAGTACCTGCATAGACTGGAC
TAATATTGGCCGCTTACATTGTTCATTACCTTGGTGGGAGGATGCATTGGTGAATTTCAT
GATCAGTGGAGGTTACAATGTCATTTCTCAGATAGAACATGTCAAGCAGAAAACACTGAT
AATTTGGGGTGAAGATGATCAGATTATTGATTACAAGCTTGCAGTGAGATTGCATTGTGA
ACTTCCAAATGCAATTCTACGCCAAATACCACAGTGTGGTCATATCCCTCATGTGGAGAA
GCCTGATGCTGTCTCCAGGTTGATAGCGAACTTTGCTCACCCTGACCAATCACAGAGGGC
AAATCCTGACTCGGTCTCCACCATCTCAGTTCCATCTTGATTACTGGTACTTGTACAAGC
AGATAGTTAGCATATCTCACGCGTGAAGATCCGACTTCCTGATTCTACCTCGTGATGAGG
TTAGTTTGCCAGTTTCAATGGTGAATATGCTCTCATTCTTTGAGCACCGTCAACCTCATT
GCATGCATATCGGTTGTCAAAGGTGCTTTGGTGCTTTTAACTCCAGCAGAGAAGTGTAAT
AAACTGAAAACTTGAGCAGAGTATTAGCTGAATGCTTTAGGAATTAGGATTCTGGTATAT
TTTTCTTCCAGCACATGCTAATCTTATTTTATATCAATTACCAGTTACTATGAACTAATG
TGATTTGCTGTTGACATATGTCTTGTTGTGCAACAAAAGTGCAGCATTTGACAAAGTTCA
AAGGTAGTTTACC