Microarray Probes on PGSC0003DMT400072760

Probe IDChipProbe Sequence
CUST_19393_PI426222305 JHI_St_60k_v1 TCTTGGGACCATATTGTATGATTGCATCATTGTGTTGTTGGGGGAGACAAAGAAGTGTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400072760

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400072760 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G13740.1 +2 5e-54 191 150/415 (36%) ABI five binding protein 2 | chr1:4713969-4715158 FORWARD LENGTH=348

Transcript Sequence (2213 bp)

>PGSC0003DMT400072760 2213 pgsc_dm_v3.4
GTTTGATTTGTTAGTATATTTCATTATTCTTTTACTCTACCCTCTCATTGCCATATTTTC
TTGATTTTCCGGCGACCCTTTTGCCGGAACACAACATTTCTTGCAAAGATTACATTTTTA
TTACTTTTTGGTGGATTTTTAACCATTTTCTTGGTTTTCCTGCCACCCTTTTGTTTTCTC
CGGGAACAACTCCGGCGATATTTACTTTTTTTTTTCCTAGTTGGGATTTCTTAAAGTGCA
AAATTTGGGTGTAAAGACTTAATCTTTGAGTTTGTTTGAGCTAATATGCAGTTAAAGATT
AGATTTTTCCATCTGGGTGTGGCTAAATCAGATCATGGAAGTGTTAAACATGCACGTACA
TGTCAGAATAGGTAAGTTTTTTAACTTTGGTTTGGTGTTCTTGATAGTATATTTGGTGGG
TGTATGGTTTGCTATGGGAGATAATACAGATGAGAAAAGGAAAAGTAGAATTGAGATGGA
AAATCTTTCTATGGAAACAAATAGATTTTCAAGGGATTTGTTGCAGAGATTCATGGGGGG
TGGTGGTGGTAGTAGTAGTAGTAGTTCAGGAAAATCTAGAGTTGAGGTTGTTGTTGCTGG
AGGGAAGGAGGTGAAGGAGGAAGAAGATGAAGGGGAAGTAGAGTTGAATCTTGGTTTATC
ATTGGGAGGTAGATTTGGTGTTGATAAATCTTCTAATAGTAATAAGTTGATAAGGTCTTC
TTCTGTAGCTTCTTGTTTGCCTATAGTGAGAGATGATGATGCTCTTGCACCACCACCAGT
GTCTTATCCTACTTTGGTGAGAACTTCTTCTTTGCCTGTGGAGACTGAGGAGGAATGGAG
GAAGAGAAAGGAGTTGCAAACTTTGAGAAGAATGGAAGCTAAGAGGAGGAGATCAGAGAA
ACAGAGAAATTTGAGAGGTGATAAAGAAGGTGGAGGAGGAAGTACTGTTGTTGGTGGGGG
AGGGAGTATGGAAGATGAAAAGAGGGAAATTGAGATGAATTTAAGAGGTAGATTAGATAA
AGAACAGTACTTGGCATCTGCGAAAAGATTTGGTTTATCGGTATCGCCAACCTTGGCTGC
TGTTGCAAGGCAAGGTAGTTTAACAGGAGGTGGAATAGATTTGACAATGGGGAAAGGTAA
AGGAAGTTATTCAGGAGGTAAAATGCAAGGACATGGGAAATTGGGGTCACAAGGTTCTGT
TGAATCCCAAGGTGGTGGTAGTTCTTCAAGTATGTCTGAATTGGAAAGTAAACTTCCACA
AGGGTCTGGTGAGCTAAGCCCTGCCAGTATCCGCTCATTACAAGGAGGGGGGAGTCAAGA
TATTGGTTTGTCTGGGTCAAAAATGAGAGATACCGGAAGCAGAATGTCAGGAGGTGATAT
GGACAGTCCATCTAAGAAGCTCGAGGCAGCAACAAATCGGGCAAAGGAAACTGGAACAAA
CACATTAGAAAATATGCCATGCGTTTTCACGAAAGGAGATGGTCCTAATGGTAAAAGAGT
AGACGGAATATTATACAGGTACAACAAAGGGGAGGAGGTAAGAATTATGTGCGTCTGTCA
TGGAAGTTTTCACTCACCAGCCGAGTTTGTCAAGCACGCTGGAGGTACCGACGTTGCTCA
CCCTCTCAAGCATATTGTCATAAACCCCAATGCTTCTCCCTTACTGTGATTGATACCACA
GGGTTTTCGGTGGAAGAGGATATCACAGAGCACACCGTGCAAAGCAGTAACTTATTCCAT
TCCCATTTTTGTTTCTTTGATTCCTCTCTTTAAGAGAAAGATATATGTATCGACTTGTGC
ACGTCTTGGAGGGATACTGGACTAAAGAAGAGTTCTGTATGTACGTTTACGGATTCTTTT
TCGGAAATTCAGAGGAATGAATTAATCTTGAATGATATCATTGCCCTCCTTACTTTGGAT
CTTAATATGTTACTACAACAATATACCTAGTGTAATTTCACAAGTCGCAAACCTTACCTC
TACCTTTGCGGGGTAAGAGAGGCTGTTTCCGATAATCCTTTATATGTCAGCTTGCTAAAG
ACTGTACATATCTTGCATTTAGTCAAATCTTTATCCATCATGATTTCTGTGTATTGGAAG
TGTCTGATGTGCTATGCACTCAAGACACTCATTTAATTTTAGAGGTTTTATGTTCTTGGG
ACCATATTGTATGATTGCATCATTGTGTTGTTGGGGGAGACAAAGAAGTGTTT