Microarray Probes on PGSC0003DMT400072045

Probe IDChipProbe Sequence
CUST_34440_PI426222305 JHI_St_60k_v1 AGCAGCTGTTTTATTATCCCGTCCATGTATAGTGAAGAAGCCAGAATTTTCATTAAGAGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400072045

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400072045 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G62280.1 +3 2e-47 166 107/233 (46%) Protein of unknown function (DUF1442) | chr5:25017165-25017985 FORWARD LENGTH=236

Transcript Sequence (1486 bp)

>PGSC0003DMT400072045 1486 pgsc_dm_v3.4
GTAGGATTTATTGCTCATAACTACTGCCCTTCCAAGAGTACTATATATTGCCCAATAACC
TTCAAAGTCTTCACCCAACCAAAGAGTCCATCCAATTTCAAAGAAAGAAAATGGCATGCT
GGTCACCTGAAAGTGCAACCAAAGCCTATCTCAAAGCAATAAAAATGGGAAAGAGTGCTA
AAGAGCCAGATGTATCAGAATTCATATCAGCACTTGTTGCTGGAAACAATGCACAACTGA
TGGTCGTCGCATGTGCTGGTGCAGCCGATTCCACCACACTAGCCCTTGTGGCTGCAGCTC
AGCAAACTGGTGGTAGAGTCATTTGCATCCTCAACGACTTCGATAAATTAAATCCATCAA
TTGAATTTCTACAACATAACGCGATGCACGTTGAATTTGTAATTAACGGAGATGCCAAAA
CTCTACTAGTAAATGACTATAGAAGAGCAGATTGTGTAGTAATTGATTGCAACATTAACA
ACTGTGAAGGCATTTTTAAGACGGCACGAAGGATAGGGGGAAATAATGCCATTGTTTTAG
GGTACAACGCGTTGCGAATGGGATCATGGAAATGTGAAAGTTTTAATGCTCATTTGTTAC
CCATAGGAGAAGGTTTATTGGTGACACGGAGAGGCAGTGATTTTGGCGTTTCGGAGAAAA
AGAGTCGTTGGATCGTCAAAGTGGATCAATGTACAGGGGAAGAACATGTATTCAGGGTCA
GATCTCCACATGGAAAACCTCTTGAAGCATAATTTTTTATTTATTGCTATTTGATAGATT
GTAGAATATACCATATAATACTTTTCTAACATCTGAAATGATAAGCAGATATGCATTTTG
ATCCTGTAAATAGAAGAGATTTAATCATGTTATAGTAGACTCACAACATAGCTGTTGGGG
TTGAGTTAGACTCAAGTGTCATACTTTACATACATGATATCTGAGTCAGATCCATCCCCG
TTTGGGCTCCTGATCCATGTTTCAGTCGGATCAGATTTACTCATGAAGTGTCAACTAAGA
TCTAATTAGGTTAGAGAACGTGCAGAAGAATAGTTTAATTTCTTCTTTATATATCACTAT
ACACAACAACATGATCTTTTCTGCAGAATCAGAAGAATGGGGCCTGAATGAAAATGCAAG
AAAAACATGGTTATTGGCATTATATGCACGTTATAGATATATTGATGAGGAAACATCTTG
ATCTGATCTACATCTTTGCTTGTTTGTCCTGAGGCATAACAAACTAGTGTCCTGTTATGC
TTCTCAACAGCCAGGCTATTCTAAATTCCATTATATTACTTATTAGTGGAACTTCATGTT
ACCTAGTATGTAGCAGCTGTTTTATTATCCCGTCCATGTATAGTGAAGAAGCCAGAATTT
TCATTAAGAGGTTTAAATAAAATAGTTTTATTATTATTTATATGTAGTAGTATAATTTTT
TGGATGAACTTACTTGACGCTGCTGCCCAAGCTAGTTTCATTTGCC