Microarray Probes on PGSC0003DMT400072022

Probe IDChipProbe Sequence
CUST_50383_PI426222305 JHI_St_60k_v1 CCTTAAATATGCACCGAACGCTTTTAGTCTTTTAAATTTATGGCTTTGTTTGGTTTCGGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400072022

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400072022 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G51680.1 +1 1e-77 245 131/269 (49%) NAD(P)-binding Rossmann-fold superfamily protein | chr3:19173622-19174667 REVERSE LENGTH=303

Transcript Sequence (1184 bp)

>PGSC0003DMT400072022 1184 pgsc_dm_v3.4
CATTCAATGAGAGTGTAATACACTCATTATGTCATGTAAGCAAAAAATGTTAAAATGACA
CAAGGAAACTTTACATGAAGTGTTTAAAATGAACGTCACTTGACTAAGATGTATAAGTGA
AATATGGTGTCAACTTTAGAATGTCATCGATGAGTTAAGCCCAAGATTAATGTTAAGCAA
AGTTATAGTATTTTTTATGTGATTAACCATATATTACATAAAACATAAATATGAAAGGAA
ATATTAAAATAACATCCATGGCCATTGTATTACTTTAGGCTTGAAGGTAAAGTTGCAATC
ATAACTGGTGCTGCTAGTGGCATCGGTGAAGTGGCTGCAAGACTTTTCACGAGACATGGA
GCTGTAGTGGTGATTGCAGACATTCAAGATGACTTGGCCCAAAAAGTTTGTGAAAATTTG
GATCCATCATCAATCACCTATGTTCATTGTGACGTTACAAAAGAAGATGACCTAAAAAAT
GTGGTGAACACTGCGGTTTCCAAGTACGGCAAACTCGACATCATGTACAACAATGCGGGT
ATTGTGGATGAAATAAAATCCAACATTCTTGATAATGAAAAATCTGAATTCGAGAAAGTT
ATTAACATTAACCTCATAGGTACATTTGTGGGGATTAAAGAAGCAGCCCGAGTCATGATC
CCTCGAGGTCAAGGTAGCATAATTTCCACTGCTAGTGTTTGTGCATCGATAGGCGGTGTT
TGTTCTCATGCCTACACGAGCTCAAAGCATGGTGTTTTAGGACTTACTCGGAATGCTGCA
GTTGATTTAGGACGATATGGTATTCGTGTGAATTGTGTGTCGCCATACACTGTTCTTACA
ACTATGGGTTTATATACCTTAAAAAAAATAGGCAAGGACAGTTCAAATGTTTATTCTAAC
TTGAAAGGTGCTACACTTACTCCCAATGATGTGGCTGAAGCTGCTGTTTTCTTAGCAAGT
GACGAGTCTAAGTGTGTGAGTGGCCATGATTTAATTGTTGATGGAGGATTCACTGTTGAG
AATTCAGGTTCATCCATGTTCAAGTAATTAATTTTACTTGATAAATGTAAAAGAAAATAA
TAAAAAAAGCGTGTCTTACGTTTGAGGGAACGTTCAAATATTTCCTTAAATATGCACCGA
ACGCTTTTAGTCTTTTAAATTTATGGCTTTGTTTGGTTTCGGAT