Microarray Probes on PGSC0003DMT400071866

Probe IDChipProbe Sequence
CUST_34433_PI426222305 JHI_St_60k_v1 GTCCCACATGGTTGATCAATATTTTCTAAAGACAATGGGTGAAGACTTTAGCCATATCGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400071866

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400071866 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G25420.1 +2 2e-171 489 240/349 (69%) 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein | chr4:12990982-12992409 REVERSE LENGTH=377

Transcript Sequence (1326 bp)

>PGSC0003DMT400071866 1326 pgsc_dm_v3.4
CTCCTAACGGCTTTCGTTTTTTTCTTCATCATTTCTCTCTTATAACTTTCCTATTTAATT
TTCTCTAAGAAGAAAATTCATGACAATGGCCATTGATTGTATGGTCATGCCTATGATACA
AACATCGTCCGATGAGAAAAAACCACTCATTTTCGATTCGTCCGTGCTTAAACATGAGTC
CAACATTCCTAGACAATTTATATGGCCGGACCACGAGAAGCCTAGTGGTGGTGTTCCTGA
ACTTGATGTTCCACTTATCGATTTAGGGGCGTTCCTTTCTGGTGATCCAATTGCAGCTAA
GCGAGAATCTAGGCTCGTTGATGAAGCATGTAAGAACCACGGTTTCTTTCTTGTGGTAAA
TCATGGTGTTGACACTAATCTTATCTCACTTGCACATCGTTATATGAACATGTTCTTTGA
GTTACCACTTTCCAATAAGCAAAAGATTCAAAGGAAGAGAGGAGATCATTGTGGTTATGC
TAGTAGCTTTACTGAAAGATTTTCGTCTAAGTTACCTTGGAAAGAAACACTTTCTTTTTC
ATATTCTGCCCTACAAGGCTCGTCCCACATGGTTGATCAATATTTTCTAAAGACAATGGG
TGAAGACTTTAGCCATATCGGAAAGTTTTACCAAGAATACTGCAATGCGATGAGCACTCT
CTCTTCTGGGATCATGGAACTCTTGGGTGAAAGCCTGGGCGTGAGCAAGAACCATTTCAA
ACAATTCTTTGAAGAAAATGAATCGATTATGAGACTCAACTATTACCCAACATGTCTAAA
ACCAGATCTTGCGTTGGGAACTGGACCACATTGTGACCCAACATCATTAACCATCCTCCA
TCAAGACAGCGTCTCAGGGCTTCAAGTTTTCATGGACAATCAGTGGCGCTCCATCAGTCC
AAATCTTAGTGCTTTTGTCGTTAACATAGGCGACACATTTATGGCGCTTTCAAATGGAAG
GTATAAAAGTTGTTTGCACAGAGCTGTAGTAAACAACAAGACACCTAGAAAATCTCTTGC
TTTTTTTCTTTGTCCTAAGAAGGATAAGGTGGTGAGGCCACCAGCAGAATTGGTGGACTC
CAATAATCCTAGAATATATCCAGATTTCACATGGCCAACTCTCCTTGAGTTTACACAAAA
GCATTATAGAGCTGATACCAACACTCTACAATTCTTCTCCAATTGGCTTCAACAGAGAAC
TACAGAGGTTTAAGGCATACTCAATAAGTTTCTAGTAGGATTTCTGATATCCAATGTAAA
TCAAGACCTTAGTCTTTTTGTATATATATATATTCCATGTTATTTAAATTGTTTGAGTTA
CGAAAA