Microarray Probes on PGSC0003DMT400071762

Probe IDChipProbe Sequence
CUST_49178_PI426222305 JHI_St_60k_v1 CTGTGGAGAAAGTAAAAGGTTCCTCAGGCCTTAAATTCTTTAACATTATTGTCCAAAAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400071762

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400071762 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G39830.1 +1 0.0 687 324/484 (67%) Cupredoxin superfamily protein | chr4:18479103-18481184 FORWARD LENGTH=582

Transcript Sequence (1567 bp)

>PGSC0003DMT400071762 1567 pgsc_dm_v3.4
CGAATATTGTAGATTGGAACACCATGGGCTGATGGAACAGAAGGTGTGACACAATGTCCT
ATTGTGCCAGGGGATACTTTTGTATACAAATTTGTTGTTGATAGGGCTGGAACATATTTG
TACCATGCTCATTATGGTATGCAAAGACAAGCAGGACTTCAAGGAATGATCAGAGTATCA
TTACCTGATGGAGTTTTAGAGCCATTTTCATATGATCATGATAAGAGTATTCTTCTCACT
GATTGGTACCACAAGAGCACTTATGAACAAGCAACTGGTCTTGCTTCTTTGCCTTTTTCT
TGGGTTGGAGAACCACAGTCAATCTTGATTCATGGAAGAGGAAGATTCAATTGTTCTATT
CCAAGCATAGATCCTACTCTTTGTAATGCTACAAATCCTCAATGTACACCTTATTCAATG
ACTGTTGTTTCTGGCAAGACTTATAGGCTTAGAATTGGCAGCTTGACTGCTCTTTCTGCT
CTAAGTTTTGAAATTGAGGGGCATAACATGACGGTTGTTGAGGCAGATGGTCACTATGTG
GAGCCATTTGTGGTAAAAAATCTTTTCATTTATTCTGGAGAAACATACTCAGTCCTAATT
AAAGCTGATCAGGACCCTACAAGAAATTATTGGGCTAGTACAAAAGTTGTCAGCAGGAAT
AATACTACTCCAAATGGTTTGGGTATTTTCAATTATTACCCAAACCATCCTAGGAGATAT
CCTCCTACTGTACCACCCCCGGGGCCACGTTGGGATGACGTTACCCCCAGGATGGCACAG
AGTGTTGCGATCAAGTCCCACAAAGATTTCATCCATGCCCCTCCTCTGACATCGGACAGG
GTCATTGTCATGCTCAACACACAAAACAGGGTGAACGGGTATGTACGTTGGTCAGTCAAC
AATGTCTCGTTCAACATGCCTCATACGCCTTACCTGATCGCCCTTAAGCACAACTTATTA
CATACTTTTGAGCAAACCTCTCCTCCAGACAACTATGACCACAAGAATTATGACATCTTC
AATATCGCGCCCAATGTGAATGCTACAACTAGCAACTCAATTTATCGATTGAAGTTTAAC
ACAACAGTGGACATCATATTGCAAAATGCCAACACAATGAATCTAAACAACAGTGAGACA
CATCCTTGGCATTTACATGGACATGACTTTTGGGTCATGGGCTATGGTAATGGAAAGTTC
AACCAATCTATTGACCCAAAGAATTACAACTTTGTGAACCCAATAATGAAAAACACAATC
CCAGTCCATCCTTATGGATGGACCGCATTGCGATTTCGGGCCGATAATCCAGGAGTTTGG
GCCTTCCATTGCCATATTGAGTCACATTTCTTCATGGGAATGGGAGTTGTATTTGAAGAA
GGAATTGAGAAAGTTGGCAAATTGCCTACTTCTATCATGGGCTGTGGAGAAAGTAAAAGG
TTCCTCAGGCCTTAAATTCTTTAACATTATTGTCCAAAAGATTACTTTAGTTTGATATTG
TTTGGATTCTTTTGATAGTTGCCAAAAATAAAAAAAAATGTGTTCCTTTTTGTTTTAAAA
CATCTAC