Microarray Probes on PGSC0003DMT400071403

Probe IDChipProbe Sequence
CUST_3107_PI426222305 JHI_St_60k_v1 TGTGCCCGTTTATCCGAGGAGTTTTCTAGTTAATTCAATGGCGAAGAGATTTTGATTTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400071403

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400071403 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G45760.1 +2 1e-27 106 73/201 (36%) BON association protein 2 | chr2:18847125-18847748 REVERSE LENGTH=207

Transcript Sequence (707 bp)

>PGSC0003DMT400071403 707 pgsc_dm_v3.4
CTTTTTCTATTATTACTACAATTACAATACAATGAATCCTTTATCGTCTTCATCGCGTTT
GTTAGAAGTAACGGTGATATCCGGCGAGAATCTTCTAGATAACCGAAAGCAACCGGTAAA
GAAGAACGCTTTTGTAAATATCAAATCAGAATCTTATTCATGCAACCTCCAAACAACTAA
AATGGATAAAGAAGGCGGAGGTTTTCCTAAGTGGAACGAGAAATTGATCGTTGATTTACC
CATGCATGCGCGTCATCTAACGGTGGAGGTTCAATGTAAAAATTCCTCCGGGATCAAAAC
CGTTGGGATCGCAAAAGTTCCGACGTCCGATTTTATTGGAGGAATTTTGCCCGAAGATTA
TTTGCATTTTTTGAGTTATAGGCTTAGGAATGAAAAAGGGGAGAAGAATGGGATAATTAA
TTTTTCTGTTAGGGTTAAGAATGCGGCGCCCCCGTCTCAAAGTGCGGCCGGCTGCGCTGC
GGCTTATACGCAGCAGTGGACGGCCGCACCGATAGATATGGGAATTAGTTATAACGGTTC
TTGTGGGGTTGTTACGGGTGTGCCCGTTTATCCGAGGAGTTTTCTAGTTAATTCAATGGC
GAAGAGATTTTGATTTTATTTTTTTACTATTTGTTTTAATCGATTAAAATAAACAACAAA
AGAAATTGTATAGATATGTTTTAGGATGAATTTAATTACTGCGAAGG