Microarray Probes on PGSC0003DMT400071285

Probe IDChipProbe Sequence
CUST_31874_PI426222305 JHI_St_60k_v1 AATGGTGAAGATGCTTGTTGAAATGGGTGCTGACCCTACTCTCACTGAATTGCATCTTGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400071285

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400071285 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G31820.1 +3 2e-20 96 85/275 (31%) Ankyrin repeat family protein | chr2:13530350-13532562 FORWARD LENGTH=662

Transcript Sequence (1807 bp)

>PGSC0003DMT400071285 1807 pgsc_dm_v3.4
GTAGGGCTTGCATTTCGTACTGTCAAAACAAAGAGTGTTACCTCTTTGTCCGATTTTGTG
TTTTTCTTCAACCTCTTGTGTATGGTCCCCACGAAATCACATGTACCCATTATTTAGTAT
CACATGCATCGTTTTTGTATGTATATAACCCGACGTCTGTGTAATATCCCTGTATCAATC
TTGAAATTTGAATCTTGAAATCATATTCCCTTTCAAAATTGGAGCATAAATTATCATTGA
TGGAGAAATTGGTGGAAGTATCAGAACCAGAAATAGGAATAGATTTTGCACTAGGCTGCA
AATGCCGAGCCACAGTGAACCTCAGATCACTTACTGCAGCCTATCCAATAGCATTCAAAG
TTCAAACTTCTTCTCCTCACAAATTCCTTGTCAATCCACCCAGTGGCCTAATATCACCTT
TATCTTCAACCTCTTTCCAAGTGATTCTCAAGCCCCAACCCCAAATCCCTCCCACTTTCC
CTCGCTCCCCTTCTGATCGCTTCCTCATTAGAACAACAATAGCGTCAGAACTCGAACTCG
AACACAACTCAGCTTCTGAGTCGACTCGATCCGAAATCGTGAACTCCTGGTTCAAGTCAA
TTGGGCATCGTTCAACTCATGACATAAAACTCAAGGTGGTTTTCGTAGGTCCTTTTCTTC
TCCGTCATGCCGTTAGTAACGGAGATTGTGATTCCGTTAGGAATATTATCAAACGGCAGC
GATCCATTTTCACCGAGTTTTCAACCCGGGAAGCAGAGGCACTCTTCCGAGTAGCAAAGC
AGCTCCCTAATAACAACAACGACATGGTGAATATTTTGATTGAAGGTGGACTGAAGGTGG
ACTCATGTACTGAACCAAACGACGTTAAATGGGTGTCCAAGGGATGGACGGCGTTACATA
TCGCCGTCGCGAATGACCGGAGGGAAGAGATTGAGAGGTTATTGACAGTGAACGGAGGGT
GCAGGTGGTTGGATAGCAGAGACAAGGAGGGAAGAACGCCGTTACATTTAGCAGCGAGTA
AAGGGTTAATGGAAAGTGGTAAGGTGTTGATAGGTGCAGGTGCGCAAGTGGATGCGAGAA
GCAAAGATGGTCGAACAGCTTTGTTCAGAGCTGCTGCTAATGGCGACTGTCAAATGGTGA
AGATGCTTGTTGAAATGGGTGCTGACCCTACTCTCACTGAATTGCATCTTGGGCGTTCAG
CTCTTGATATCGCCAGAGCTAAGGGACACGGGGTAGTCGTTACAATACTCGAAAGAGGAG
AAGCAGTTCTACATGCAGCAAGGCGTGGAGACCTTCAGCTACTCGAGACTCTTCTCGAAA
AGGGAGCAACCACCAACTTCCACGATCAATATGGTCTAGCAGCACTTCACATGGCAGCTA
TTAAAGGAAAAAAAGACGCAGTAATGATATTGGCTGAATTTGGAGCCGACTTGGAATGTC
AGGACATAGAAGGTCACACTCCGCTGCAAATGGCAGTCGAAGGCGGATGTGCACAGACGG
TAGAAGTGCTGCTGAACAGAGGAGCCAATGTAAATGCCAAGAACAAGAAAGGTGCCACTC
CACTTTCTGTTTCTAAATTTTTGGGTTTTGAAGAAATAACGCAGCTACTCGTTGATGAGG
GTGCAGTGCTTTCTGTAATTCCTTCAAATTCTCCATCTCCCGTATCTTGATTTTTGGCTA
TGTAGATGTACAACTTTAATGAATATATGTATAATATCAGGCGATTCAAGTAATGAACAA
AGTATAAATTTTCCGTCTTTCCAACAAATCTTTGAAGTTCTACATCGGTCAAACAATAAG
ACTCGTC