Microarray Probes on PGSC0003DMT400071278

Probe IDChipProbe Sequence
CUST_31838_PI426222305 JHI_St_60k_v1 ACAGACTCACATTCTTTGAGCTAGAAGACAACTTACGGGTTCAGCTGAATCAAGTAGGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400071278

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400071278 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G39510.1 +1 2e-46 164 102/304 (34%) nodulin MtN21 /EamA-like transporter family protein | chr2:16491358-16493085 REVERSE LENGTH=374

Transcript Sequence (1032 bp)

>PGSC0003DMT400071278 1032 pgsc_dm_v3.4
ATGGCTATGGAAAAGTTCAAACCTCATCTTCTTATGATTTTAGTACAAATTTGCTACACT
TTTCTTTATTTCATTACTGAAGCTTCATTCAGCCATGGGATGAACCCTCATGTCTACGTA
ACTTATCGAAACATTGTGGGAGGTCTAGTTATATTACCGTTCGCGTATGTTCTTGAAAGA
AAAAAGAGACCAAAGTTAACTATGGCTTTGCTATTGGAGTTCTTTGTACTTTCTCTAATG
GGAGTGAGTTTTTTGAACATGTACTTTGTGAGCTTGACTTTCACTTCTCCAACATTTATA
GCTTCTATGCTCAACACTATTGCTGCACTCACCTTTGTATTGGCAGTAATCCTCAGGTTG
GAAATTGTTAATGTTGAAGACCCTAGAGGAATAGCAAAAATCATAGGAACACTTGTTTCT
TTGGCTGGAGTTATGATTATGACATTGTACAAAGGAGCAATTTTGAAGAATTTATGGCAT
CCTATTATATATATTCATCAAGGAAACAATGTTGTCAAGGAAGATTGGGTCAAGGGATCA
ATTTTGACTATTGCTAGTTGCATTACAAGGGCCATATGGTACATCATGCAGGTTGGCTCG
ACAAGAGTTAGGCTATGTCCAGTTTTGGGTCGTGACAGACTCACATTCTTTGAGCTAGAA
GACAACTTACGGGTTCAGCTGAATCAAGTAGGCTTACACACAGAAAAGATATCCAGCACA
ATTGTCACTGACAACATGGAGCAAAAGGGACCTGTTTTTGTGACTATGTTCAATCCACTA
TCAACTATACTAGTGGCACTTCTAGCATACTTTGTGTTTGGGGAAAAGCTATATATGGGC
AGCATCATAGGAGCAATAATTGTCATTGTTGGCCTTTACTTGCTCTTGTGGGGAAAAGAA
GATCCAAAATCAGAGAGAAAAGATGAAGAAAAATGCTGCACAATAAAAAAAGAATTACAT
CATGAAGACAATATGATGCAGAAATTCACATCAGATGCTAATCCTATGGATACTAAAAAA
CCAAAACAATAA