Microarray Probes on PGSC0003DMT400071160

Probe IDChipProbe Sequence
CUST_49952_PI426222305 JHI_St_60k_v1 ATAACCCGAGGTCTCAGGTTTGAGTCAGGTATGGAGTCGCCTTTGTTAGTAAGCACTTAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400071160

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400071160 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G54210.1 +1 1e-85 271 143/201 (71%) Ribosomal protein L17 family protein | chr3:20067672-20068385 REVERSE LENGTH=211

Transcript Sequence (1985 bp)

>PGSC0003DMT400071160 1985 pgsc_dm_v3.4
CTTATCCATTCAGATAAACCCACAGCTCATTCGGAACATAACCAGAGAAGCAAAATATCA
AACTAGGAAGCTATGGCTTCTGCAACTTGGAGCATGTCTTGCTTGAAATCGGCTCTTCCT
TCAATTCAACCAATTTCCAACTCTTCACTTCGATTCTCTTCTGGGTCTTCTCCATCTCGT
CTCAGGATTTGCAAACCCAAGTCCAGTTCAACAATTATTCAGTCCTTCGTGGGTCTTGCT
CCCCTGCATCCACTTTTGTCCCTCTCTTCCCAAGACTCAAAAAGTTTTGAGGACTCATTC
ACCATTATTGATAGTGGTGGCCGAGTATTTGCCATGAGACATGGCAGGAAGGTCCCCAAA
CTGAATAGACCTCCTGATCAGCGTCGGGCACTTCTGAGAGGTCTCACAACTCAGCTCCTC
AAGCATGGGCGTATAAAGACCACTAAAGCGAGGGCCAGGGCGGTTAGAAAATATGTTGAC
AAAATGGTCACAATGGCGAAGGATGGCTCTCTTCATAAGAGAAGGCAAGCTCTTGGGTTC
ATCTATGAGAAGCAGATAGTGCATGCATTGTTTGCTGAAGTTCCCGAAAGATATGGAGAG
AGGAATGGAGGATATACTAGAATAATAAGAACTCTACCAAGGCGAGGGGACAATGCACCG
ATGGCATACATCGAGCTTGTTTAGCAACTGAAAAATTTATTTTCCAGGTTCATTTTTGTT
GGTTCTGAATTATGATGTGATCTAAGAGATTTGTTGGTTCACCAATTATTCCATCCCAAT
TTCCTGTATGCCGTTCAATTTTGATTTGCAATACTACTCTGTTTATTTGGTTGGTCACCT
TTGATCCGTTTCAAGCATTTAGTTTTTGACCACTCCATGTTATATCAAATATGGTTATTT
TGATGGAAATTGCCAGAACATGATAGTGTAACAATTTTTCTACATCAACCAATAAATGCA
TGAACGGAGATTAGGATGGGGGAAAACCACTAAAGCAACCCGTCTCAGCAAGATTGGATA
AATAAGCCAATATTGTAGGATGAAACCGAGTGTTGTAACGTTTAGTACTGCTTATGAAAC
AAAAATAAGTAGAAGCTGCATCTACTGCTGAAGTGGAGCAATATCTGTCTGAGGAAGAGT
TGCATCATTCCTGCTTACTGTCTTTTATGAAAGGAATTGGTAGTTTTTGAAGAACCTTCT
CATCCACTTGACTATACTGTTTCCTGAGTTCTTTTATAGCCATTTCTCCATAGGTATCTA
CTTGATCTCCATACTTCTCATAGAAAAATGGTACTGTCAACAGCATGACAGTTGCTGTCC
AAAAAATGAAAATTTTGGTTATCTTGGTAAATCACTATGAACACAGAAAACAGGTCACAC
ATCAACCAACCTACTGAATTTCCACATACCAGTGAGGAAATTTCGTAAGTTAGGCTTGTG
CAGCCAACAGAAACAAAATGGAAGTGTATAGAGAACTTACTGAGGTATACAAGGGTCAGA
AAACTGAACCATCTGCCAACAATGGAAACAATCCACAAGCTAAAAATTGCCTGCAGAGGA
GCATTTAATCACATGAACTTGTTGCAGTTGAAATGGACTTTACTAGTAATAACAAAGTTC
AAGGTGTGGGAAATTTTACATATAGAAACTTCTTCAAATCATTTCCGGATGCTACTTCCC
GAAAGATACCAGATACACAGGTGCATTGATCCCTCAGTAAGAGGACCAATTGCATCCATA
TCTCTTCTGGCAATTCAATCTTTGGTAACTCTACAAAACTCCTGCCAGAGAATACAAGAT
GATCAATTTAGTACAACGCTCGAGCAAGAAGCACAACTAGCAAAAACATGATTGCAGATC
AGGAGGAGAGTCAGATGATTGGAACCAACTCATAAATACCAGCATTTAACTCCTTCATCC
ATAACCCGAGGTCTCAGGTTTGAGTCAGGTATGGAGTCGCCTTTGTTAGTAAGCACTTAT
CCCCC