Microarray Probes on PGSC0003DMT400071155

Probe IDChipProbe Sequence
CUST_49955_PI426222305 JHI_St_60k_v1 GTATATTGAACTACTAAGCTCTTGGAGGAGTGCAATTTAACTCGTTGTAATGAGTTACTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400071155

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400071155 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G12800.1 +3 2e-105 310 178/209 (85%) photosystem I subunit l | chr4:7521469-7522493 FORWARD LENGTH=219

Transcript Sequence (917 bp)

>PGSC0003DMT400071155 917 pgsc_dm_v3.4
GTAAGAGTTTCATCCACCCTAAGAACCACCAATCTGTAAACCCAAAAGATTTTCTTTGCC
AGTCATTAACAAGACTTGTCTGCATCTTTTGTTATATTCTAACTAACTGATCAAACAAAC
AGAGCCAAACAATATTTTCCAAAATGGCTACTGCAGCATCCACAATGGCTAGCCCGTTGA
AGAGCAGCTTTGCTTCGTCTTTAACCAGAGGTCACGGCCTTGTTACTCCCAAAGGCATTT
CTGGTGCACCTTTTAAGATTTTCCCTTCAACAAGAAAGTCTTGCTTCACCGTCAAGGCTG
TCCAAGCTGATAAACCAACTTTCCAAGTGATTCAGCCCCTTAATGGTGACCCTTTCATTG
GAAGTCTTGAAACTCCAGTCACCTCAAGTCCATTGATTGCATGGTACCTCTCCAACTTGC
CTGCCTACCGGACCGCGGTGAACCCACTTCTCCGGGGAGTAGAAGTGGGCCTGGCCCATG
GATTCTTACTAGTTGGCCCATTCGTAAAGGCTGGCCCATTAAGAAACACAGAGTATGCAG
GGGGAGCTGGTTCTTTGGCAGCAGCAGGACTTGTTGTGATCCTTAGTATGTGTTTGACAA
TTTATGGAATTTCATCATTCAAAGAAGGAGATCCATCAACAGCACCAGCATTGACATTGA
CTGGCAGGAAAAAAGTGCCAGATCAATTGCAAACTGCAGATGGATGGGCTAAATTCACTG
GTGGATTCTTTTTTGGTGGAATTTCTGGTGTCACTTGGGCTTATTTCCTCCTATATGTTC
TTGATCTTCCTTACTTTGTTAAGTAAATTTCTTTAATTGATGTAACTATTTTGAATGTTA
AATTGGATATGAAAGATGTATATTGAACTACTAAGCTCTTGGAGGAGTGCAATTTAACTC
GTTGTAATGAGTTACTT