Microarray Probes on PGSC0003DMT400070911

Probe IDChipProbe Sequence
CUST_27422_PI426222305 JHI_St_60k_v1 TTGCTCTTCTGTTGCTCTTTTGGTTGACTACTGGATCTTCTAATTCAAGGTGTTTCTAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400070911

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400070911 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G63840.1 +1 3e-16 73 29/54 (54%) RING/U-box superfamily protein | chr1:23689991-23690491 REVERSE LENGTH=166

Transcript Sequence (545 bp)

>PGSC0003DMT400070911 545 pgsc_dm_v3.4
CAAAAAATAAATAAAATGTCATCATTCACTAAATTCTTCTCATTTTTCAATAAACTCATC
AACATTTTATTCTCCTCATGGATTCCTCAAGCATTAACATTCATAATGCTTTTGTTTTTA
GTTTCTATCAGTGCATACGAACAAAGACAACAAAGTTACAATTGTTGGAAAGTTATAAAC
AAAAAGAGCATTAAATTCGTTTACAAAAAGCGAAAATTACTTGGATTTGTTGCAACTGAA
CCGATTGATTGCGCGATTTGTTTATCGGATTTCGAGCACGGAGATAAAGGAAGGAAAATT
GAAAGGTGCAGTCATATTTTTCATGAAAATTGCTTAGATAAGTGGTTGATGCACGGGAAA
GGACAAGCCACGTGTCCGCTTTGCCGGAGCGTAATTATACCGGAAAATATGGTGGATGAT
CACCGGAAAGTTGGAGATGAAAGACTTACGTTTGGTTTATTTGAGGAAGAACTTGCTCTT
CTGTTGCTCTTTTGGTTGACTACTGGATCTTCTAATTCAAGGTGTTTCTAATTATCAAAT
TTTGC