Microarray Probes on PGSC0003DMT400070848

Probe IDChipProbe Sequence
CUST_27404_PI426222305 JHI_St_60k_v1 GCAAACAAGGGCGAAGAACCACCTACTCAATTATCAGACGAAGAAACAAATCCTTGCTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400070848

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400070848 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G26270.1 +1 0.0 688 348/474 (73%) phosphofructokinase 3 | chr4:13301094-13304030 REVERSE LENGTH=489

Transcript Sequence (1407 bp)

>PGSC0003DMT400070848 1407 pgsc_dm_v3.4
ATGGGATCATTGGTTGATAGTGTTGCAGTGCATAACTTGAACAAGAAGATTGTGATGGGT
GACAATGGTTATGTTCTGGAAGACGTTCCTCATTTGTCTGATTATATTCCTAGTCTTCCT
ACGTATCCTAATCCATTGAAGAACAATCCTTCCTATTCAGTCGTTAATCAGTATTTTGTC
GATAAAGATGATACAGTTGCTCAAAACATTGTTGTCCGCAAGAATAGTCCAAGAGGGATA
CATTTTCGTCGAGCTGGTCCTTCCCAAAACGTTTATTTTAAGTCCGACGATGTTAATGCA
TGTATTGTAACATGTGGAGGTTTATGTCCTGGTCTTAACACAGTTATCAGGGAAATAGTA
TGTGGCCTATACTCTATGTATGGTGTAAGAAGAGTGATGGGGATAGATGGAGGATATCAA
GGTTTCTATTCCAAAAACACGATTCCTTTGACACCTAAGGTTGTGAATGATATCCATAAA
CGTGGTGGAACGATTCTTGGGTCATCTCGAGGAGGTCATGTTACGAAGAAAATAGTTGAT
AGCATTCAGGACCGGGGTATCAATCAGGTTTATATAATTGGAGGAGATGGAACACAGAAA
GGAGCATCGGTGTTATTTGAGGAAATTACAAGGCGTGGTCTGAATGTTGCAGTTGTTGGA
ATCCCCAAGACAATCGATAATGATATACCAATTATTGACAAGTCTTTTGGTTTTGATTCC
GCGGTTGAGGAAGCTCAACGTGCTATTAATGCTGCTCATGTTGAAGCTACGAGTTTTGAG
AATGGAATTGGGGTTGTGAAGTTAATGGGACGGGATAGTGGGTTCATAGCAATGTATGCT
AGTCTTGCTAGTGGAGATGTTGATTGTTGTTTGATTCCAGAATCTGATTACTATCTTGAA
GGACGTGGTGGAGTGTTTGAGTACATAGAACAAAGGCTCAAAGAGAATGGACACATGGTT
ATAGTTGTAGCTGAAGGTGCCGGACAAGAAGTTGATGTTGGTTTATGGATATCGAAAAGG
ATAAAGGAGCATTTTTTGAAAGAAAAGAAGATGATGATCAATCTTAAATATATAGATCCG
ACATACATGATTCGGGCTATTGCAAGTAATGCATCTGATAATGTGTATTGCACACTTCTT
GCTCAAAGTGCTGTACATGGAGCAATGGCTGGCTACACAGGCTTTACGGTTGGTCCTGTC
AACAACACACATGCTTACATACCCTTTGATAGAATCACTGAGAAACAAAACAAGGTTGAC
ATTACAGACATGATGTGGGCACAACTTCTATCTTCAACAAATCAACCTAGCTTCTTGTCA
ACAACGAGATCAGCCGATATAATTGAAGCAAACAAGGGCGAAGAACCACCTACTCAATTA
TCAGACGAAGAAACAAATCCTTGCTAA