Microarray Probes on PGSC0003DMT400070567

Probe IDChipProbe Sequence
CUST_637_PI426222305 JHI_St_60k_v1 GAATGCATAGTTTGTCAATTTGGTTGCGAATGATTGAAATTTGTTCTATCGTGAGGTGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400070567

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400070567 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc00g170200.1 +1 2e-80 246 118/128 (92%) evidence_code:10F1H1E1IEG genomic_reference:SL2.50ch00 gene_region:18003903-18004286 transcript_region:SL2.50ch00:18003903..18004286+ functional_description:Hydrolase alpha/beta fold family protein (AHRD V1 ***- D7L528_ARALY)
TAIR PP10 AT3G24420.1 +1 3e-92 282 140/265 (53%) alpha/beta-Hydrolases superfamily protein | chr3:8863111-8864883 REVERSE LENGTH=273

Transcript Sequence (1181 bp)

>PGSC0003DMT400070567 1181 pgsc_dm_v3.4
CAATATGTTGCATTATATGGTGTTGGCCGGCCAATAAACCTCTTCCTTTGCTATATATAA
AAATATATAGTAAGTAGCTATAATAGCAATAAGTAGAAAATGGTGATATTGGATTTATTA
AGAAATATGAATGGAAGAATAATAGGGTCAGGAAAAGAAACAATAATTCTAGCACATGGA
TATGGAGGAGATCAATCAATTTGGGATAAAATATTGCCCAAATTATGTGAGTCTTACAAG
ATTGTTTTGTTTGACTGGTGTTTTTCTGGTGCTAATCTATTAAAACATCATTTTGATGCT
GAAAAATACTCTTCCTATGAACCTTTTGCTGATGACTTGATAGCTCTTGTTGATGAAATG
AAGTTGGAATCTTTTATATTTGTTGGTCATTCCATGTCTGGCATCATTGGTTGCATTGCT
TCTATCAAAAGACCAACACTCTTTAAAAGGCTCATCCTTGTTTCATCTTCTCCAAGGTTC
ATTAACGTGGAGGATTACGAGGGAGGTTTCGACATAGCAGAGATGGAAGAGATGTTTAGA
AACATTGAGGAAAAGTATGATGTTTGGAGTACAAATTTTGCTAGTATAGCTGTGGATTCA
AGTGATCCTCCTTCTGTTGACAAATTTGATAAATGCTTGAAAAGAATGGGAGTTGAAATT
GCATTACCTTTAGCCAAAAGTGTTTTCCTAAGTGATTATAGACACATTCTTGATAAGGTG
ATTACCCCATGTACCATAATTCAAACCAAGGTTGATTTTGCTGTTCCAAACTCGGTTCCC
ACCTTCATGCACAACACTATCAAGGGAGAATCCACTGTTGAGATCATCAACACTAATGGC
CATTTCCCGCAGCTCACTGCTCATCAAGAATTCCTTAATGTAATTCATAGAGTCTTAACT
TCTTAGAACAAATATTATACTATAATATGATCATTTGTGGAATAATGTACTAGTGATCTT
GTATCCATGACCTTTATTGGATACACAAGATGATACTAGCTAGCTAGCTTCGTTTTTTGT
TAGGATGATTTGTATGGTTTTCGTGTCACACTTTGGGCTAATAGTGTTTTGAATGCATAG
TTTGTCAATTTGGTTGCGAATGATTGAAATTTGTTCTATCGTGAGGTGTTTAATTTCTTA
GGTTTCATTTTCGTTGGGTAAAATAAAGTATTTGTTTCGGG