Microarray Probes on PGSC0003DMT400070196

Probe IDChipProbe Sequence
CUST_21375_PI426222305 JHI_St_60k_v1 TGTATGGCAGCCGGCGGAATTTGCAAGGGATTTGTTACCTACACTCTTCAAACATAGCAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400070196

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400070196 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G41690.1 +2 2e-58 191 108/203 (53%) heat shock transcription factor B3 | chr2:17381723-17382577 FORWARD LENGTH=244

Transcript Sequence (970 bp)

>PGSC0003DMT400070196 970 pgsc_dm_v3.4
AACAAAAAGGGGTTGTTTATTTTGTGTTTCTCTACTCATTTTACCAATTTTCTTGAAAAA
AATAATATTTCCTTTTTTTTGGTTTTTTGTTATGGAGGTATTAGAAGAAGTTCAAGTAAG
TGATGAAAAGAGTTTGTTAGAGTATGTTGTGATGAAGAAGTCATCACCATCACCATTTTT
GTTGAAAACCTACATGTTGGTGGAAGATCCGGCGACGGACGACGTCGTTTCTTGGAATTC
CGATGGATCGGCGTTTGTTGTATGGCAGCCGGCGGAATTTGCAAGGGATTTGTTACCTAC
ACTCTTCAAACATAGCAACTTTTCAAGCTTTGTCCGGCAGCTCAATACCTATGGTTTTCG
TAAAATTACAACAAGTCGATGGGAGTTCAGTAACGATAAGTTCAAAAAGGGCGAAAAGAA
TTTACTCCGTGAAATTCGTCGAAGAAAAGCTTGGACAAATAGGCAACAACCAAACAACGG
CGGACAGAGCCAGGACGCAAATAGTAACAACAAGAAAGATAATATTACAGAAGAAGATCA
AAGATCATCATCATCAACTTCATCATCATCTGAATATATAAATCTTGTTGATGAGAATAA
AAGGTTGAAAATGGAAAATGGAGTCCTTAGCTCTGAGCTTTCACTCATGAAAAACAAGTG
CAAAGAATTAATGAATATTGTTACAATATTTGCTAAAATTCCAGAGAAAGAAGAAGAAAA
AAAGCCAATGTTATTTGGAGTAAGATTAGAAGTTAAAGAAGAAATGGAGAGGAAGAGAAA
AAGAGTTGAACTTAATGAAATAGCTAGTGTTTTTCTCTCTCAATTATGCAAATAAAGTAG
AAATTTAGAGAGAAAAATAATCAAGTGGTTAATTAATAATATATGTAACAGTTGTACTAT
GTTATTTTGTATTATTTCATGCAAAATTAATAGTATTAATTAGCATGTAGTGACTACTAA
TTAAGTGGAG