Microarray Probes on PGSC0003DMT400070037

Probe IDChipProbe Sequence
CUST_21421_PI426222305 JHI_St_60k_v1 TGCTGTGATTAATGGATGGGAAAATGAAGAAGTTCAAAAGGCTACTTCATGGATGAAGAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400070037

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400070037 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G41870.1 +2 1e-38 144 128/224 (57%) Remorin family protein | chr2:17471119-17472519 REVERSE LENGTH=274

Transcript Sequence (1573 bp)

>PGSC0003DMT400070037 1573 pgsc_dm_v3.4
GTGGTTCATATCACTTTGACCATATTTTCTTTGATTAAACTATAGTCCAAAAAAATAATA
ATCAAGATGATGTTGCTTTTTTCTCCCTTTTATTTTTCACCCTTCCATTTTCCTTTTCTC
CTTCATCCACTTGTATGATCATTCTACCAAATATACACTAAAAACCTAACAAAATCCCTA
TAGAAATTAAGAAATCAACAAAAACCTTGTCATGTCTAATGATCAAAGAGCTCTAGTCCT
ATCAAGCAACAACAATAATAGAGACAACAATCATGAAGATCATCAGGATCAAGATCAAGA
TCAAGATCAGAATCAGAATCAGAATCATCGAGATGATCATATCAGAGATATCCACACTAT
GTCACCACCACAACCACCAGTACCACCAATCATGATGAATATTAATCGTGCAGGACGAAG
AAGGGAAGCTTGGGAAACAAGTAGTCATAGATCATCATCTTTGTCCTCAGAGTTAGGAGG
AGTTCCAAGTGAGAATTTCACAACCATGAGTAGAGAGTTCAATGCTTTGGTACTTGCTGG
ATCTTCTACCAACAACAACGACGACAACAACAACAACAACAATAATAATGGTACAAGTCA
TGAAGTTGAAGGTACAATCAATAATAATTTAGGAAGGATTTTCGAAGAGGAGACTATAGT
CGAAGAAAATAATTCTTTAGCTATTGTAGCAGATAATACGAATAATAATAATAATAATAA
TAATTACAACAATAATAATGTTTATTTAAACCCTAGTGCTCCTTCTCCTAACAATAATTT
GAGTGAAATTAGTCAACAAGGAGAAGTGATTGTACATAGAGTGAAGAAAGAGGAAGTTGA
ATCAAAGATTAGTGCATGGCAAACTGCAAAAATTGCAAAGATTAATAATAGGTTCAAGTG
TGAAGATGCTGTGATTAATGGATGGGAAAATGAAGAAGTTCAAAAGGCTACTTCATGGAT
GAAGAAAGTTGAGAGGAAGTTAGAGGAGAAAAGAGCAAAAGCACTAGAAAAGATGCAAAA
TGATATAGCAAATGCAAGAAGAAAAGCAGAGGAAAGAAAGGCATCAGCAGAAGCAAAAAG
AGGAACAAAAGTAGCTAGAGTTGTTGAATTAGCCAATTTGATGAGAGCTGTTGGTAGAGC
TCCAACAAAACGTTCATTCTTTTAAATTTACAAAAAAAAAAAAATTAAAAAAAGTGTGTT
AGATAATTGATACTTTGTGTTTTGCTATATCGAGGAGCTTCTACTTATAGTGATGGATTC
AGGATTTAAATAATGTGAATTCTGAATAGAGAGAGTGTGTTCTAAAATGTATATATAGCT
CTCCTATCGGTTCATTTGGTTCTGTCAACAAATCGTCTTCCTTTTAGGAGGAAGATGATC
TTGAAGTATTAGGTTTTGTCGAACTCACAAACCATATGGTTGGATTCTCTATTAGTTTCT
TACAACATTATATTATATATTTTCAAGTGTATTGTAGCACTCTAAGAGTATGGTGAGTGA
GTGAATGGTAGTAAGGAAACACTTTGGACAATTGTTTAGATGTTAAATTACATAAATATA
TGGTGTGTTAGAT