Microarray Probes on PGSC0003DMT400070024

Probe IDChipProbe Sequence
CUST_21380_PI426222305 JHI_St_60k_v1 ATTTAAGGTTCTTCAAGTGAAGCTTGTGAGAGCGAGTTCCTAAACTCTGCGTTGAGGCTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400070024

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400070024 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G31850.1 +3 0.0 1260 656/1085 (60%) proton gradient regulation 3 | chr4:15403020-15406358 FORWARD LENGTH=1112

Transcript Sequence (4251 bp)

>PGSC0003DMT400070024 4251 pgsc_dm_v3.4
AATTGCTCTAACATATCCACGTCTTCCTCATCCTCACTCAAAATTCCAACCCACATGTTT
ACTTCAGTCCCAACTCCATAATCACCCGAAAAGCAATCTTTTTGCCTCATCATTATACAT
TTCTTATGCAGAACTTGTTCAGATTGTGCTCATGTAAGTTTTTGCATATAAATTTACTTT
CTTTTTTCCATGGGTGTGATTGTACTTAGCTCCTCAGCAAGTTGCTGCAATAATTTCAAT
TGTGTATCTGTTACTGAGACTAGACAATCTACTAGTGGTAATGGGTGGTTGAATTGTGAT
AAAATTAGGAAAAAACATGTGGGTTCTTCAAGATTTGTGATGAAATGTTCCAATGATGTT
GTGTTGGCTGGGAACTTGAATTTTTTCTCAGGTGGGTCTGTGGTGAATTGTGATAAAATT
AGGAAAAAACATGTGGGTTCTTCAACATTTTTTATGAAATGTTCCAATGATGTTGTGTTG
GCTGGGAACTTGAATTTTTCTCAGGTGGGTCTGTGGTGAATTGTGATAAAATTAGGAAAA
AACATGTGGGTTCTTCAACATTTTTTATGAAATGTTCCAATGATGTGTTGGCATGGAACT
TGAATTTTTTCCCAGGTGGGTCTGTGTTGAATTGTAATAAAATTAGGAAAAAATATGTGG
TTACTTCAAGTTTTGTTATGAAATGTTCCAATGATGTTGTGTTGGTAAATGGAAAACCTA
GAAATGGCATATCTGCTGAGGGACTATTGAGGAACTTGAGGTCGATTTCGGAACCAACTG
AAGCTTTAGCTTTGTTTAAATCTGTAGCGGAGATGCCTAGGGTTGTGCATACTACGGAGA
CATGTAATTACATGTTGGAGTATTTGAGGGTTCTTGAGAGGATTAATGATATGGCTGTAG
TGTTTGATTTGATGCAAAAACAGATAATATATAGGAGTTTGGATACTTATTTGATTATAT
TCAAGGGTCTTCATATAAGGGGAGGGATACGGGAAGCTCCGTTTGCTCTTGAAAGGATGA
AGAAAGCAGGGTTTGTGTTGAATGCTTACTCGTACAACGGGTTGATTCATTTGATTCTTC
AAGCAGGGTTTTGGCAGGAAGCTTTAAAGGTTTATAGAAGGATGATTTCGGAAAAGCTTA
AGCCTAGTCTTAAAACATACTCTGCGCTAATGGTTGCGTGTGGTAAAAGAAGGGATACTG
AAACAGTCATGAGATTGTTAAGCGAGATGGAAGGTCTGGGATTAAGACCGAATATTTATA
CTTTTACCATTTGCATTAGAGTGCTTGGAAGGGCTGGAAAGATCGATGATGCTTGTGCTG
TATTAAAGAGAATGGATGATGAAGGTTGTGCTCCAGATGTTGTTACTTACACAGTCCTCA
TTGATTCTCTTTGCATTGCTGGCAAGCTAGATATTGCTAAAGAAGTCTTTTTCAAGATGA
AAGATGGGTGCCAAAAACCTGATCGAGTGACTTACATCACTTTGCTAGATAGGCTTAGTG
ATCGTGGTGACTTGGACTCTGTAAGGGACTTCTTGGACAGGATGGAGGCTGATGGTTATA
AAGCGGATGTCGTCTCTTTTACCATACTTGTTGATGCTTTGTGCAAAGTAGGTAAGGTTA
GTGAAGCATTTGCTACATTAGATGTAATGAAGGAAAAAGGGATCTTACCGAATCTTCATA
CTTATAATTCATTGATTAGGGGCCTGCTAAGAAAGAAGAGAGTTAATGAAGCATTGGAGC
TGTTTGATAGCATGGAATCTCTTGGAGTTGAGGTTACAGCTTACACGTATATCCTGTTTA
TTGACTACTACGGAAAATCAGGTGAGCCTGATAAAGCCCTTGAAACATTTGAGAAGATGA
AAGCTCATGGAATCGTGCCTAACGTTGTTGCTTGCAATGCATCTTTGTACAGTGTAGCAG
AAATGGGAAGGCTTGGAGAGGCGAAAAGGATATTTGATGGAATTAGAGAGAGTGGATATG
TTCCAAATTCTATCACCTACAACATGATGATGAAATGCTATAGTAATGCAGGGAAAGTTG
ATGAAGCCATTAAATTACTCTCTGAGATGATAGAAAGTGGTTGTGATCCTGATGTAATTG
TAGTCAATTCATTGATCGACATACTTTATAAGGATGGTCGGGCTAGTGACGCGTGGGCAA
CGTTTTACAGTTTGAAGGATATGAAACTAACTCCTACTGTTGTGACCTACAACACTTTAC
TGGCTGGATTAGGAAAAGAGGGGAAGATTCGAGAGGCCTATGAGTTACTTGATAGCATGG
CTCTTCACGGGTGTGCTCCTAACACAATCACTTACAATACACTTTTAGATAGTCTTTGCA
AGAATGGTGAGGTTGATACTGCCTTGACGTTGCTTTATCAAATGACAGGACCAAATTGCT
TTCCAGATGTTTTCAGTTATAACACTGTAATCTTTGGGTTGGCTAAAGAAAAAAGGGTAA
CTGAAGCATTTTTGCTATTCCATCAGATGAAGAAGAAAATGTATCCTGACTGTGTAACTG
TATATGCTCTTCTACCTATTCTTGTGAAAGACGGTTTGGTTGAGGATGCTGTTAAGATTG
TGGACGGATTTGTTTACCAGGCTTTGAACAGGTCAGATAGATCATTTTGGCTGCAACTGA
TGGAAGGTGTTTTGGGTGAAGCTGAATTAGATCATTCCATTTCTTTTGCGGAAAAACTGG
CATCGTATCATATTTGCAGAAGTGACTTAATAATAGTGCCTGTTATTAGAGTCCTTTGCA
AGCAAAAAAAAGCCCTTGATGCTCATGATCTTTTTGTTAAATTCAAGAACACATTCGGTA
TTCGTCCAACACTAAGATCATATTATCCCTTGGTTGAAGGACTTCTGAATGTTAATCTTA
AAGAATTGGCGTGGCATCTTTTCAAGGAGATGAAAAATGCCGCCGGTTGTGCCCCAGATG
TTTATACCTATAATTTGTTTCTTGATGAACTTGGAAAGTCTGGGAAGGTTGATGAACTTT
TTGAGCTGTATGAGGAGATGCTCCACAGAGGATGTAAGCCGATCGCGATAACTTACAATA
TTCTCATTTCTGGTTTGGTGAAGTCTAATAAAGTAGAGAGAGCAATGGATTTTTACTATG
ATCTTGTAAGTTTAGGGTTTACACCTACTCCTTGTACATATGGTCCTCTCATAGATGGGC
TTTTGAAAGTTAAAAATTTCGACAAAGCAAAGGACTTCTTTGAGGAAATGGCGGAGTACG
GATGCAGGCCGAATTCCGCTATCTACAACATTCTCATAAATGGGTTTGGGAAAGCCGGTG
ATCTGAAAGCTGCATGTGATCTCTTTAACAGAATGAATAAAGAAGGAGTTAGACCCGATT
TAAAGACGTACACCATTCTTGTAGATTGTCTATGCTCTGCCAGGAAGGTGGATGATGCTT
TGCACTACTTTGAGGAACTGAAATCAGCTGGTCTTGATCCTGATTTGATTTCTTACAACC
TTATGATCAACGGTCTTGGGAAATCCGGTAAAATGAAGGAAGCGCTGCATCTTCTTGATG
AGATGAAAAGCAGAGGAATCACCCCGAATCTTTATACCTATAATACCTTGATATTCAATC
TTGGGATTGTTGGAATGTTGGAGGAGGCTGGAAGGATGTATGAAGAACTTCAGCAATTCG
GTCTTGAACCCGATGTTTTTACTTATAATGCTCTTATTAGAGGGTACAGCAAGTCTGGAG
ATCCAGATGGTGCATATGCCATTTATGAGAAGATGATGGTCGGGGGTTGTAGCCCAAATA
GTGGTACTTTTGCTCAACTACCTAATTAACGGCAGTCATTTAAGGTTCTTCAAGTGAAGC
TTGTGAGAGCGAGTTCCTAAACTCTGCGTTGAGGCTGCTAAGGGATTACCTCTGCTGATC
GGACGTTTACTATTTGGAGCTCGTAGATGTGTCAGCAAGGTTCTTGAGGGGCGGCTGAAC
CTCAAAGGTTTCGGATTTCATTTGTAAGGTGCTCTATAAATCCGAAAACGTTGTCTATAT
AAAGTGTTAATATTTGGTTGTTGTAGGTTTATACCTGTGCATCTTGTAAGAATGAGTGTG
GCAGTCTTAGCAATAAGTGTAGCATATCTCTTATGCTTGGTGAATCCATGGTGCCTATAT
CTGTAGATAATTCAACCATAGTTGAGGCAAAACTCTTTCTAAAGTTTTGATTTGTTATTC
AATTTACCAAGAAATGTTTTAATTCATTATTTACACTGCTTTGTTATGTGA