Microarray Probes on PGSC0003DMT400070004

Probe IDChipProbe Sequence
CUST_30329_PI426222305 JHI_St_60k_v1 TTCGCTATCGTCCCAAGGAGGGTGACTCATGTTTAAATATTGTCTATTGAAAATAACATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400070004

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400070004 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G02220.1 +2 5e-17 73 36/59 (61%) unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:441884-442102 REVERSE LENGTH=72

Transcript Sequence (478 bp)

>PGSC0003DMT400070004 478 pgsc_dm_v3.4
AACAGCTTCCTGAAGAAGTCTGTACTATTATAAAATCTCACACACACATGCTCTTTGTTA
ACTCAATTTTTTCTTGATTCTCACGAGTCTGTTTATAATCACGACTGTTATAACTATTTT
CAATTTTTGAGAGAGATTGGCGCGTTATGCGATTATGGTGAAGAGTGATTATGAATTGGT
GGAAATAGATGAAGGATGCAACACACCAAGGCATGATAAATATAGGATTTTGGTGAATTC
CAAGTGCCCGCCGCCAACGCCAAGGAAGAAAAGAATTTATGTGAAACAACAAAGTTCTCC
ACCTAAGGAAGGTTATTTTCAGCCTCCTGATCTTGAGATTTTATTCGCTATCGTCCCAAG
GAGGGTGACTCATGTTTAAATATTGTCTATTGAAAATAACATGATAATTTACTCTGTTTG
TTTTTTTTAGATGTGTCCAAGATTTTGTACAATGTAGAATTGGTTTAGCACTATGGGG