Microarray Probes on PGSC0003DMT400069933

Probe IDChipProbe Sequence
CUST_30333_PI426222305 JHI_St_60k_v1 GTGTCTCTGATGTTTAGAGTTTGTGCATGTATATAATGGTGGTTTGAAAATTTTATGGGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069933

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069933 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G55580.1 +3 1e-152 421 228/324 (70%) Regulator of chromosome condensation (RCC1) family protein | chr3:20612766-20615730 FORWARD LENGTH=488

Transcript Sequence (1773 bp)

>PGSC0003DMT400069933 1773 pgsc_dm_v3.4
CTCTTTATCAGATTCTGGAAAGATCATTACTTGGGGTTCAACTGATGATTTAGGACAATG
CTATGTGACATCAGGGAAACATGGAGAAATTCCGGAGCCTTTTCCCCTTCCTGATGAAAT
TTCTATAGTTAAAGCCGCAGCGGGTTGGGCACATTGTGTTGCTGTTACAGAAACTGGAGA
AGTTTATACATGGGGGTGGAAGGAGTGCATTCCTTCTGGAAAGTTTCTTGGGGAGCAAGC
CGTAGACAAGGAGGTAAGCGACGGGCAGAGTTCATTCCCGGCACAGCAAGGTATTTTTGG
ATTGGCTTCACTGTCGCAAAGAAGCACAATCTGCTATTTACATTTTACAGAGTAATATTT
TGAAGATTAACTTTATCACAGTAAGCCGTCACCCCCAGGGATCGAGATCCAAGGTTGGAG
CAGCACCTGGTATAGAGACTAGAGGGGGAGAGGATGGTGCAAAACGTAGACGGGTATCAT
CAGTGAAGCAACCAGCTGAGAGTTCATCCCCAGGTGATGAAGGTCCCTCAGCATTGCCAT
GTTTAGTCACACTGAATCCAGGGCTGCGGATTGTCAGTGTAGCAGCTGGTGGGCGGCATA
CACTAGCATTATCAGATATAGGACAAGTGTGGGGTTGGGGCTATGGAGGGGAAGGACAGC
TTGGCCTAGGCTCCAGGATTCGAATGGTGTCCTCCCCACATCCTGTGCCATGCATTGATT
CTTCTTCTTTGCGGAAAGACAGAGCTATGGGCCTTTCTCATGGATGTCCGGGGTCAGAGG
GACAAGGCCTCAGAGTTCCTGGGAATTACATCAAGAGAATTGCCTGTGGGGGCCGACACA
GTGCAGTAATTACAGATGCTGGAGCACTGTTAACTTTTGGTTGGGGATTGTATGGACAGT
GTGGTCAAGGGAGTACAGATGATGAGTTAAGTCCCACGTGTGTATCTTCATTACTTGGCA
TCAGGATAGAAAGTGTAGCTGCAGGGCTCTGGCACACTGTATGTATTTCTGCTGATGGTG
ATGTATATGCATTTGGAGGGAATCAATTTGGGCAGTTAGGCACTGGTGCCGAGCAGGCTG
AGACACTACCTCGGCTCCTGGATGCTCCAAGTTTGGAAAACATGCATGTGAAAGTTGTAT
CTTGTGGAGCACGTCATACTGCCGTAGTCACAGGTGATAGCAAAGTATTCTGCTGGGGGT
GGAACAAGTATGGTCAGCTTGGACTGGGTGATGTGATCGATCGAAATATTCCATCCCAAG
TCTCAATGGATGGTCATGTACTGACAAATGTCGCTTGTGGATGGTGGCACACACTTCTAC
TAGCTGAATCACCAACTTGAACTATTACTCATCTTATTGATGCAAATTCACCAGTTTTGC
TAGGCTAGGTGCCTTTGGTTCTCTATTCAAGATATGATATATGCATATGGTACATATAGT
AGTTTGCTTGCATATATAAATTCTTTAGTTGCAAGAATAAGGTGGTCATCGTCATCCTAC
CAAGGCAGCAACATGCAAAGAAAGATATCGTCTACCTATCGTGTCATGTCAATTTAGGAT
ACAGTGTAAATCCTCTTCGCTACTGGATTTTCTGATGTATCGAAGATACTCTGGTATTGT
TTGTTAGAGCAGCAACTATTATAGCTTTTGGGGGTACTCTTTTCGGGTTCAGACGTTGTT
AGACTGTTGTAATTTATCAATCTTGTGTCTCTGATGTTTAGAGTTTGTGCATGTATATAA
TGGTGGTTTGAAAATTTTATGGGCAAGTTTCAG