Microarray Probes on PGSC0003DMT400069927

Probe IDChipProbe Sequence
CUST_30327_PI426222305 JHI_St_60k_v1 TTTAAAGGCAATAAAGATCAGATATTTGAATGATCCCAGGAACATTCCCTTCTTCATGCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069927

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069927 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G39830.1 +3 0.0 643 347/511 (68%) DA1-related protein 2 | chr2:16619950-16623658 REVERSE LENGTH=528

Transcript Sequence (2114 bp)

>PGSC0003DMT400069927 2114 pgsc_dm_v3.4
GCCGTTCAAAATTGCAGCTTGCCACTGCCAGTGTTTACCTTTCCATCACAATCCTTCTCA
GCAGATTCCCAAATTTCCTCTTTCTGTTCAAGCCAAGAATCTTTCTCTCACACAAGATTC
TCATAAAAACTTAGGCTTTATACATGATGCCATTGTTCCATTTCTTTTCTCTATACACCC
TTCTTTCTCATTCCTACTTTGTCCTCTTCATTTTTAAGCCACCCTTTTCAAATCTTGAAA
AATCTCAACAAATTTCTTCTGTTTCTATACATATCGCAGTATCCTAATCAATGTCTTCTT
CAAGTGTCAATCATATATCTCAGCCTTGCATATATGGTCACTTTGTTTCTTCAACTACTG
AGAGAAAGTCAAGATTAATGAAATGGCTGAGTAAACTTTTCAAGGGTGGTGGGTCAGGTA
ATAGGAGACAGCAACCACAGTTTCTTGGAGACGAAAATATGGTTTGGCGAGCTCCAGCCA
GATCAATGGATGATAACTCTAGGACCAATAAGGAGAAAGAGGAACTAGACCGTGCAATTG
CACTCTCTCTTGCTGAAGATTTGAAAAGACCAAAAGGATACAGATGGAGGACTGACCAAG
ATGAAGATCTAGCAAGATCGCTTCAAGATAACTCGAATTCATCCTCATATCCTCCTAAGT
ATGCTCCTTCATATGCTCCTTGGGAATATAATCCCAATAGTTACAGAAAATGTAGTGGCT
GCAATAAGGATATCGTCTCTGGCAATTATTTGGGATGCATGGGAACTTTCTTTCATCCAG
AATGTTTTCTTTGTCGTGCTTGTGGTGTCCCAATTACTGAATACGAGTTTTCTTTGTCAG
GGAACAATACATATCATAAGTCATGCTTCAAGGAAATGACTCATCCAAAATGTGAAGTCT
GCCATCAATTTATCCCAACAAACGGAGCTGGCTTGATCGAGTACAGATGCCATCCATTTT
GGTCTCAAAAATATTGCCCTGCACATGAGAATGACAATACCAAACGGTGCTGTAGTTGTG
AACGTCTGGAGTCACGGAATGCAAGATATATGTCACTTGGAGATGGTCGGAGCTTATGCT
TAGAGTGCATGGAATCTGCAATCATGGATACCGGGGACTGCCAGCCACTTTACCATTCCA
TCAGAGACTATTATGAAGGCATGAACATGAAAATAGATCAGCAAGTTCCTATGCTTCTTG
TTGAAAGACATGCCCTTAATGAGGCCATTGAAGGGGAGAAACATGGTCTCCATCATATGC
CTGAAACCAGAGGTCTATGCCTATCAGAAGAGCAGACAGTCACCAGTATACTCAGAAGGC
CAAAAATAGGTGGTCGTGGATTAATAGGAATCAGAACACATCCTCAAAAGCTAATTAGAA
GATGTGAAGTTACAGCTATCCTAGTAATATACGGCCTTCCAAGATTACTTACTGGTGCCA
TTCTAGCTCATGAACTGATGCATGCCTGGTTACGTCTAAAAGGATATCGTAATCTCACCC
CTGAAGTAGAAGAAGGAATCTGCCAAGTGCTTTCCCACATGTGGCTTGAATCAGAGGTAG
TGCCTGGATCAAGAAATATGCCATCTACATCAACTGCTTCGTCATCGTCTACATGGTCAT
CATCGAAGAAAGGAGGAACATCTCAAGCAGAGAGTAAGCTCGGTGAGTTTTTCATGCACC
AGATTGCCCATGATGCTTCTCCAGCATACGGTGGAGGATTTAGAGCTGCTTATGCAGCCG
TGAATAAGTATGGTTTACGGAGTACATTGGATCACATTCGCTTGACAGGAAATTTTCCTT
TATGATATGTTCGTTGTGACCTCTTTGACCTCGTATGCTCGTAGATGATTTCCTCTCCTG
TGTGCCAAGTTAGAAGTCATCGATGAGGAAAATGAGTTGATCATGCAGAGCTGGTTTAGC
TACCCCTATTTTTTCCGGGGTCCTACCGGAGATACTGATGGAATACAACTTGAATCTTAC
AAATAAGTCTACATATTTTGCAATTAAAATGAAATATATAGAAAATTCTATCTTGTATTG
GAGACTCTTATCAGTTTAAAGGCAATAAAGATCAGATATTTGAATGATCCCAGGAACATT
CCCTTCTTCATGCA