Microarray Probes on PGSC0003DMT400069841

Probe IDChipProbe Sequence
CUST_30306_PI426222305 JHI_St_60k_v1 GTACCTCAAGAGGTTGGAGATTCATATAGAGTTATCATTAATCACCATAAAAGCATCTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069841

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069841 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G06490.1 +1 5e-79 250 126/146 (86%) myb domain protein 108 | chr3:2004298-2006358 FORWARD LENGTH=323

Transcript Sequence (1260 bp)

>PGSC0003DMT400069841 1260 pgsc_dm_v3.4
CATTTCTCTTCTTATATCATATTAATATTTCTCTCTCTTTTTCTCTATTTGTACCCTTTT
TTTTTGTATCAATCAATTAGTTTCTTCATTTTGAGTAAGCAAAAAAAAAAAGTTTAGATG
GAATATCATGGTCAGAAAATTGAAGTTGATTCAGGACGAGGACGAGAAGGAGGACGAGGA
GATTGTAATGAAAATAATCAAGAAATTAAGGAGGAAGATGTTGTTATGGAGCTTCGAAGG
GGTCCATGGACCGTTGAAGAAGACTTTACACTTATCAATTTTATTGCTCATCATGGTGAA
GGTCGTTGGAATTCTCTTTCCCGTTGTGCTGGTTTGAAGAGAACAGGGAAAAGTTGTAGG
TTAAGATGGCTTAATTATCTTCGACCAGATGTTCGACGTGGCAATATTACTCTTGAAGAA
CAACTCTTGATTCTTGAATTGCATTCTCGTTGGGGCAATCGTTGGTCTAAAATCGCTCAA
CATCTTCCCGGAAGAACAGATAATGAAATCAAAAATTACTGGCGCACTCGAGTGCAAAAG
CATGCAAAACAACTCAAATGTGATGTGAACAGCAAGCAATTCAAAGATACCATGAAGTAT
CTTTGGATGCCAAGGTTAGCCGAAAGAATACAAGCCACCGCCGCGGCTACTTCCAACCCA
ACGGCGGCTTCTTCCTCCGGCCCCACCGCCACCACCACATATATCCAAAATCAAGAAATT
CAACATCCACTACCAAACATGAATCATCATGTACCCGAATACTTACCTATCCAACTGATG
AATATTGAGAAAACAAACAGTCTTAATTATTCAGCAACTTCAGCGTCATCAGATAATTAC
TCATCCGACCTCACTGATGGTTGCTACAATTTCCCAATTAACCAAAGCAATAATCAAGAT
CATTCTCAAGTTAATCAAAGTACTAATCAATTTTGCTATGGAGAATCCACAATAAATCCC
ACAAGTTATAATTTTCACCCTGGATTTCAAGGATTCCAAGAAGTGGATCAACAAAACAAT
ACACAATGGATGGAAAATCCATGGAATATTGAAGATGTGTGCTTCTTACAACAATTGAAC
AATGACATGTGATACAAATATAGTATCCAAAAGTACCTCAAGAGGTTGGAGATTCATATA
GAGTTATCATTAATCACCATAAAAGCATCTACATTTTTTTTTTAAAAATTCTTATGCAAC
ACATTTGTAGCTTTTATGTACCAAATTGCCATCAATTACTTAGTTTTATGTTTTTTTAAT