Microarray Probes on PGSC0003DMT400069840

Probe IDChipProbe Sequence
CUST_30447_PI426222305 JHI_St_60k_v1 AAGATACAAGCTGCATGTCGAGTTTAAATGCCATCAATGGTGAGTTTCATTGAGTTTTCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069840

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069840 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G48030.1 +3 0.0 816 425/507 (84%) mitochondrial lipoamide dehydrogenase 1 | chr1:17717432-17719141 REVERSE LENGTH=507

Transcript Sequence (1826 bp)

>PGSC0003DMT400069840 1826 pgsc_dm_v3.4
CAAATATATAATAGGAAAACTCGACGAAAAATTGTTCATTTTCTCAGAGCAGAAAATTCA
AGCCGGAAAAAATGGCGATTGGGAGCTTAGCTAGACGAAAGGCTTCAACAATTTTATCTT
CTAGATATCTCAAGTATTCATTTTCTCTTAGCAGAGGTTACGCTTCGGGATCCGATGAGA
ACGACGTCGTTGTTATTGGTGGTGGACCCGGCGGCTATGTGGCGGCGATCAAAGCGGCGC
AGCTAGGTCTCAAAACTACCTGTATTGAGAAACGTGGTACTCTTGGTGGTACTTGTCTCA
ATGTTGGCTGTATTCCATCTAAGGCACTTCTTCATTCCTCTCACATGTATCATGAAGCTC
AACATTCTTTTGCTAGTCATGGTGTGAAGTTCTCTTCTGTTGAGGTAGATCTTCCTGCCA
TGATGGCCCAGAAAGATAAGGCTGTGGCTGGCCTAACACGGGGTATTGAGGGTCTATTTA
AGAAGAACAAAGTGAACTATGTCAAGGGCTATGGTAAATTCCTTTCCCCTTCCGAAGTTT
CTGTTGACACCGTGGAAGGTGGTAATACTATTGTTAAGGGGAAGAATATTATAATTGCGA
CTGGTTCTGATGTCAAAAGTCTACCTGGGTTAACCATTGATGAAAAGAGAATTGTATCAT
CTACTGGAGCTTTAGCTTTGACTGAAATTCCAAAAAAACTGGTTGTTATTGGTGCTGGCT
ACATAGGCCTCGAAATGGGATCTGTCTGGGCCCGCCTTGGCTCAGAGGTGACTGTTGTTG
AATTTGCATCTGATATTGTTCCAACCATGGATGGTGAAGTTCGCAAGCAATTCCAACGTT
CTCTCGAGAAGCAAAAGATGAAGTTTATGCTTAAAACTAAGGTGGTGTCAGTTGACACTG
TTGGCGATAGTGTGAAGTTGACCCTCGAACCTGCAGCTGGTGGTGAGCAGACTACTCTTG
AGGCTGATGTTGTTCTTGTTTCTGCTGGTAGGGTTCCATTCACTTCAGGACTTGGATTGG
ACAAGATAGGTGTTGAAACTGACAAGGCTGGTAGGATCTTGGTCAATGAACGTTTTGCCA
GTAATGTTCCAGGGGTATATGCAATTGGTGACGTCATTCCTGGGCCAATGCTTGCTCACA
AGGCAGAGGAGGATGGTGTTGCTTGTGTGGAATTCATTGCAGGCAAGGAGGGTCATGTGG
ACTACGATTTGGTTCCTGGTGTTTGCTACACTCACCCAGAGGTGGCTTCCGTTGGGAAAA
CTGAAGAACAGGTTAAGGCACTTGGAGTTGATTATCGCGTAGGCAAATTTCCTTTCCTTG
CAAACAGTAGGGCCAAGGCAATTGACGATGCTGAAGGAATTGTAAAGGTAATTGCTGAGA
AGGGGACTGACAAAATCTTGGGCGTCCATATTATGTCATCAAATGCAGGGGAGCTTATTC
ACGAAGCAGTCCTGGCTATGAATTATGGAGCATCGAGTGAAGACATTGCTCGTACATGCC
ATGCACATCCAACAATGAGCGAGGCTCTGAAAGAAGCAGCCATGGCCACTTATGACAAGC
CCATTCACATGTAGAGATAGTGTCATATCATTGTTTTTTTATTTTCCTTCGAGTATCTCG
AATACTTGGAGCAGATTTTCTAATTGCCATATCATTCCTCAAGTATATCTGGAACAGAAG
TTTCCTCCCCCTCCCCTCTCTAAATTGGGTACTCAAACCACCTCAAAGTTAATGTTTTTC
TCTTCTGCATATTCATTACTGTAATAAAGATACAAGCTGCATGTCGAGTTTAAATGCCAT
CAATGGTGAGTTTCATTGAGTTTTCT