Microarray Probes on PGSC0003DMT400069793

Probe IDChipProbe Sequence
CUST_30341_PI426222305 JHI_St_60k_v1 GGACCATTCTACTTGCCCTCCCAAACTCCCTCCATATTTTAGTACTTTTTATGGTTTGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069793

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069793 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G55550.1 +3 3e-171 508 252/399 (63%) Concanavalin A-like lectin protein kinase family protein | chr3:20600019-20602073 REVERSE LENGTH=684

Transcript Sequence (1921 bp)

>PGSC0003DMT400069793 1921 pgsc_dm_v3.4
CTTTAAACCCCACTCTTTCACTTTCCCAACTCTTTCTTCATTCCTTTGTAATCACACAGA
CAAATCACATGTGGCAAATCAAAGTAGAACTCTACAAAAAGAATGTCTAGATTCAGCTAT
AAATCATCACCCCACACAATTCTTCAACTCTACAAACAAATTTCAATCTAACTATGCCAT
GGCCAAACAAATTACACCAACCCTTTTCTTGATTCTCTTTATTTTGCTGTCAAGAACAGT
TTTTTCTGATGAATTTGTGTATAATGGCTTTAATGGGGTTGAAGCTAGTAATCTTACTGT
AAATGGGATTGCTCAGATTTTAAAGAGTGGCGCTTTAAAGCTTACAAATGAAACATCTAG
AGTTGTTGGTCATGCTTTTTACAAAAATCCAATTAAATTCAAGAATTCCCAATCTGATGA
ATGGGAAAGCTCAATCTTTGGATCTTGATTCATTGCCTGCTCTCCCTAAGCCTAAGAAGG
ATCAAACAGTCTTGATTGTAGCTACCACGATATCGGCTGTTGTGTTTCTTGTATTCGGAC
TCGTTTTAGCCTTGTATGTCATTTGGAAAATCAAGAACATAGATGTGATTGAACCTTGGG
AACTTGAAATAGGTCCACATAGGTTTTCTTACAAAGAGCTAAAGAAGGCTACTAGGGGTT
TTAGAGATAAAGAGTTGCTCGGGTTTGGTGGATTTGGTCGAGTTTATAAAGGAACACTGC
CTAAGACGAATACCGTTGTTGCTGTGAAGCGAATACATCATGAAGCAAAACAGGGTCTTC
AAGAATTTGTGTCTGAAATCGCGACTATTGGTCGCCTTAGACATAGAAATTTGGTTCAGC
TCTTAGGATGGTGTCGGCGAAGAGGTGATTTGTTACTTGTTTATGACTTTATGCCTAATG
GAAGCTTAGACAAATACATTTATGATGAACCAAGATTTACTTTAACTTGGGATCAGAGGT
TCAAGGTTATTAAAGGTGTGGCTTCTGGTCTGTTGTATTTACATGAAGAATGGGAACAAA
CTGTGATCCATAGAGATATTAAAGCAGGGAATGTGTTGTTAGATTCCGATATGAATGGAC
GACTTGGAGATTTCGGACTTGCTAAGTTATACGAGCATGGAGCAAATCCTAGTACAACAA
GAGTAGTCGGTACGTTGGGTTACTTAGCTCCAGAATTAACCAAGATCGGAAAGCCTACAC
CAAGTTCAGATGTTTTTGCCTTTGGTGCATTGCTGCTAGAAGTTGCTTGTGGGAGGAGGC
CAGTTGAGGCAAAGGCATTGCCTGAGGAGTTAATCCTAGTGGATTGGGTATGGGATAAGT
GGAAGGAAGGTGCCATTCTTGAAGTGGTTGACTCGAGATTAAATGGCGAGTATGATGAGA
TGGAGGCCATAATGGTGCTTAAATTAGGACTCATGTGTTCAAATAATACACCATCTAAGA
GACCTAGCACGAGACTAGTGGTGAGATACTTGGAGGGGGAGGTGACACTCCCAGAGACGC
TGGCAGCTCCCGATGAATATGATGGAAAGAAGGGTGGTACTAGCGGTATGGAGTTAGAGG
ACTTAATAGATTCCTATCCGTCTTCGTCTTATTTTGAGAAAGTAAGTACATGGTCATCAG
CTTATGACGGTGAAGGCGATATTGATATTGAAGCTAATTCAGTAACGCCATTAACGGATT
CTGGCAGAGAGGACAACAGATAGCCATGCAAAATGGAGGGACCATTCTACTTGCCCTCCC
AAACTCCCTCCATATTTTAGTACTTTTTATGGTTTGATTTTTGAACTTAAATGTAAATTA
TGGCTTTTGAAAAGAAAATGATATTAGTATCAACCATTTCTATGGTTTTGAGAATATTGG
TGTTAGTAAAATGTGAATATATTTTTGCAATCAAGTCAATTTTGAATCTTGATGAAGCTT
G