Microarray Probes on PGSC0003DMT400069755

Probe IDChipProbe Sequence
CUST_30438_PI426222305 JHI_St_60k_v1 GGAGTCTGATCCGGAATTCATGCAGTTTGTTATTGGCTATTGAACTTTTCTTTAATATAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069755

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069755 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G39980.1 +3 0.0 649 334/479 (70%) HXXXD-type acyl-transferase family protein | chr2:16688437-16689885 REVERSE LENGTH=482

Transcript Sequence (1690 bp)

>PGSC0003DMT400069755 1690 pgsc_dm_v3.4
ATAAAATCAAGAAATCTCCATAATCTCATCAAAATGCATGAACCCAAATCCCAATTCCAA
ACCTATATAAAAGCCCCTTCTTACTACTCTCACTTTCATCCCTCAGCCTCAGCATCAAAT
AATCCTAATTCTATCCGCGTGTGTAATTCACCCATTTAGTGAGGGACTGTAAAGCCGCAA
TGCCTTCAGCAACGGTAAACTTGGTGTCCAAATGCATCATTTTTCCGTCGGAAAAATCGT
CACTTACCGATCTAAAACTCTCCGTTTCAGATCTTCCTATGCTCTCTGTTCACTACATTC
AAAAAGGTTGTTTATTTACTCGTCCACCTTTTCCTATACCTCAACTCATTTCCCTTCTTA
AGCACAGTCTTTCTCAGACTCTCACTCACTTTCCTCCGCTCGCCGGGCGATTCGTGACAG
ATTCAGATGGCTACGTCTACATTACTTGCAACGATGATGGAGTTGATTTTGTTCATGCTA
CAGCCACTCACATTTCCATTCGCGATGTGATAGGTTCTATTGATGTTCCTGATCATGTTA
AGGAGTTTTTCCCTTTGGACAGAACGGTTAGCTATCGAGGGCATTTTATCCCTCTTCTAG
CTGTTCAAGTAACGGAATTAGCTGACGGCGTATTTATTGGATGCGCCGTCAATCATTCCG
TCACAGACGGGACTTCGTTTTGGAATTTCTTCAATACATTTGCTGAGGTGAGTAGAGGTG
TGAAAAGGATTGTAAGGCAGCCGGATTTTACACGTGATTCTGTTTTGATTTCAAATTCTG
TGCTGAAACTCCCGGCTGATGGACCGAAAGTTACTTTCGCCGGCGATGCTCCTTTGAGGG
AGAGGATTTTTAGTTTTAGCAGGGAATCAATTCAAAGACTGAAAGCGAAGACGAACAATC
AGAAATTGAATTTCGACGGAGAAATCAATATTGTTGAATTGATGTCAAAACAGAGCAACG
ATCCACTGAAAATCAAAACAGAAACGGAGAAGATAAATCCAACGGCTGAGATCTCATCAT
TTCAATCACTCTGCGCATTGCTCTGGCGTGCAGTGACACGTGCAAGGAAATTCCCAGCTT
CGAAAATGACGACATTCAGAATGGCTGTAAATTGCCGTCATCGTCTCCAGCCGAAGCTAA
ACCCGTTATACTTCGGCAACGCAATTCAGAGCATTCCGACTTACGTATCAGCAGGAGACG
TATTATCTCACGATCTACACTGGTGCGCGGAGCAATTGAACAAAAACGTGAAGGCACACG
ATGATGTTATGGTGAGGAAGTTCGTAGAGGATTGGGAAAAGGATCCACGGTGTTTTCCGT
TGGGAAATTTCGACGGAGCTATGCTAACAATGGGAAGCTCGCCGAGGTTTCCAATGTATG
AGAATGATTTCGGGTGGGGAAGACCGGTTGCTGTTCGGAGTGGACGGGCGAATAAATTTG
ACGGGAAGATATCAGCGTTTCCGGGGAGAGAAGGAGGAGGAAATGTGGATTTGGAAGTGA
TTTTGTCACCGGAAACAATGGATGCCTTGGAGTCTGATCCGGAATTCATGCAGTTTGTTA
TTGGCTATTGAACTTTTCTTTAATATAGTAGCTTTTGCTCTTTGTGATTTTACTCAATTT
GTATTCAGTTGTGATTAATGTAATTGAGTTTAACCTTTGTTGAATTGCTAAAAACTATTA
CTAATTCGAG