Microarray Probes on PGSC0003DMT400069750

Probe IDChipProbe Sequence
CUST_30449_PI426222305 JHI_St_60k_v1 GGGAGATAGGTTAAAGACAACAAGGTCTTGTTAAGAAATGGGAATTGGAACATTTTTTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069750

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069750 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G55800.1 +1 0.0 601 320/393 (81%) sedoheptulose-bisphosphatase | chr3:20709640-20711421 FORWARD LENGTH=393

Transcript Sequence (1555 bp)

>PGSC0003DMT400069750 1555 pgsc_dm_v3.4
AAAAAATCTTTCTTTTATATTTCTTCATTGTAGGATATTTTCCCCTCTCCACTCTCAAAA
TTCTTAATTTTAACACACAAAATGGAGACTAGTGTCACATGTTGTGCAAGAGCTACATCT
CTTCTCCCAAATGTTTCTTCTCAACAATATTCAACTTCACTTGCAACTTCAAGATCCATT
TCCCAGCCTTCATTCAACTCAAGGAGTCTGAAATCAAGCTCATTATTTGGGGAATCATTG
CGCGTTGCGCCTAAATCATCACTTAAGGTGTCTAGGACGAAAAATTCTTCCTTGGTGACA
AAATGTGAGATTGGTGATAGCTTGGAAGAATTTCTTTCAAAATCAACCTCAGATAAGGGG
TTAATCAGGTTAATGATGTGTATGGGAGAAGCATTGAGAACAATTGCCTTCAAAGTCAGA
ACAGCTTCTTGTGGAGGAACTGCTTGTGTCAATTCTTTTGGTGATGAACAGCTTGCTGTC
GATATGCTTGCTGATAAGCTTCTCTTTGAGGCCTTGACATATTCACACTTTTGCAAATAT
GCTTGTTCTGAGGAAGTTCCTGAGCTCCAAGACATGGGGGGCCCTGCTGAAGGAGGATTT
AGTGTTGCTTTTGATCCACTTGATGGTTCCAGTATCGTGGACACGAACTTCACAGTTGGA
ACCATCTTTGGTGTATGGCCCGGGGATAAGTTAACCGGGATCACAGGAAGAGAGCAAGTT
GCAGCAGCTATGGGGATATTTGGACCGCGAACTACATATGTTCTTGCTCTTAAAGATGTT
CCCGGGACTCATGAATTCCTCCTCCTTGATGAAGGAAAATGGCAACATGTTAAGGATACA
ACAGAAATCGGAGAAGGAAAAATGTTCTCCCCTGGAAATTTGAGAGCCACATTTGACAAT
CCTGATTACGCCAAGCTGATCGATTACTATGTGAAGGAGAAATACACCTTGAGATACACC
GGAGGAATGGTGCCTGATGTAAACCAGATCATTGTAAAGGAGAAAGGTATATTCACAAAT
GTGATATCTCCAACAGCTAAGGCGAAACTTAGATTGCTCTTTGAAGTGGCACCATTAGGA
TTCTTGATTGAAAAAGCTGGAGGTTACAGCAGCGATGGGAAACAATCCGTCCTTGACAAA
GTGATCGTTAATCTTGATGACCGGACTCAAGTTGCTTATGGTTCCAAGAATGAGATTATC
CGATTTGAAGAAACACTCTACGGATCATCAAGGCTTAAGGCTGGTGCACCAGTTGGTGCT
GCTGTTTGAGGCTAGAGAATGCAGCAATCATATTGTTTGTTTGTTTTTTTCGCGCTTTCT
TTCTAGAGCATCGCGAAAATGCTGTTCCATCAGGTTATAAAAGGGAGATAGGTTAAAGAC
AACAAGGTCTTGTTAAGAAATGGGAATTGGAACATTTTTTGTATATTGTTGTTTCTATTA
ACTGGTGATATGCTGGATTTCAGACATAAAAGGTAAAAAAAGACAAATAATTTGTAGTAG
TATTATGTAAGATAAATTTATGTATTACAACTTGTCTGATTATGCTTCATCTCTA