Microarray Probes on PGSC0003DMT400069678

Probe IDChipProbe Sequence
CUST_16634_PI426222305 JHI_St_60k_v1 GTTGTATTCTTGTATGCAAATCAAAATACTCTGGGCAGAGGATAGACAAACCATTATATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069678

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069678 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G62270.1 +3 0.0 1059 535/707 (76%) HCO3- transporter family | chr3:23042528-23045633 REVERSE LENGTH=703

Transcript Sequence (3558 bp)

>PGSC0003DMT400069678 3558 pgsc_dm_v3.4
GTGACTCACCTCTCACTTTGTTCAAGCAAATAATCCCTCAACCGTAGAGAAGCTTACTTC
CATCAGAACTTCCATCAGCAACCCACCCACCCCCATTCCTTCTCCATATCTGCATTGAGT
TTTCTTGGTACATTTTGTTAACTTCCTATTCATTTTCTTCTGTTACTTTGTTCTATTGAC
TCATGTAAACTGGTTATTGCTCTCCTCAAATAACTAACTTTCCTGCCTAATTGTTCTTCA
AGGGTTCTAAATCTAAGTAATGTAATAGTAAAAAGCTACTATCTTTGGTACCCCTTTTGT
TTAAATCATTCATTTTCAACTTCTTGATAATGGGTTCTCGTTAAATCTCTTGATTATTGC
TTTCTTGATATACCCATTTGGTTGAACTTGCTTTAAACCACTAAAAATCACTTTTTTCTA
TAAATGGGGTCTCGCTAAATTCGTGATTCTTGGTATTTTTGTCACCAAATAGCTTTGTCA
GATAGTAATAAAGTTCTGACATGTAACTGAAAATTAGATCCCTGTTTGCCCTTTGTTCTT
GTTGAAGTGCATTTTGGTGGCAACTTGTATTCTCTATTTATACATGTAATGGATCTAGAG
CTTTTCGGAGTCAACCGTTAATTCGAGATCTTTGTAGATGGAGTACTTCATTTCCTTTCG
TTAAGGCTTGATTTTTTATATCAGTTATGGCTTTACTCCGTTAAATTTATATGAGTTGTG
GTCCTATGGAATTCAAATAGGCTTGTTTGGAGGTCTTTGACATATCTCTAGACATATAGT
ATTCATTGCTAACTGATTCTTTTGTTCTATACTAACTTGTATTCTTTGTAAATCTGTTAA
TATGTAGAGTTAGATATATAACATCTTATTTTATGGACCTTAATGAAGGTCAGTATACAG
TTAACTTAAATGAATCAGCCAATAATCTGTTTTATCCTAAACACTCTAGTCATGATCAAG
TAGGTGTTGTTGTCTTCCTGCCCAAAGTTTTTTTCCCTTTGCCTATGCAAGTCTAGTTGA
GTTTGATATTGGCCTCTCGAGCCCCTTCAATTCTGTTTTAGTTTGTTGTCCTTCAAGTTT
TCTTATCTGTCAAAACGAAACAAAAAAGAACGAAATTTCCACCCTTCATTCCGGACAAAT
TTTGAGTGATCATGGAAGAAACATTTGTTCCCCTACGTGGAATCAAGAATGATCTCAAGG
GGAGATTGTTATGCTACAAGCAAGACTGGACTGGTGGTCTCCGTGCTGGTATCAGGATCT
TAGCTCCAACGACCTACATTTTCTTTGCATCAGCAATTCCAGTTATTTCATTTGGGGAGC
AACTGGAAAGAAGCACCGATGGAAGTATAACTGCGGTGCAGACTCTTGTTTCAACAGCAC
TTTGTGGTGTAATCCATTCCATTCTTGGTGGACAGCCACTCCTTATACTAGGAGTAGCTG
AGCCAACTGTCTTGATGTACACTTTCATGTTCAACTTTGCGAAAGATCGGAAGGATTTGG
GTCCGAATCTCTTTCTAGCCTGGACAGGATGGGTTTGTGTTTGGACCGCCTTTCTGCTTT
TCTTGCTAGCCGTTCTGGGGGCGTGCTCCATAATAAACAGATTTACACGTCTGGCTGGTG
AATTATTTGGCATGCTCATAGCAATGCTCTTTATGCAAGAGGCTATTAAGGGTTTGGTGG
AGGAGTTTGGCATACCTCAAAGAGAAAATCCTCGTCAGGCTGCATTCTCACCTTCTTGGC
GCTTTGGAAATGGAATGTTTGCACTAGTTTTATCTTTCGGGCTTCTTCTTACTGCACTGA
GGAGCCGTAAAGCTAGATCCTGGCGCTATGGATCAGGCTGGTTTCGAGGATTTATAGCTG
ACTATGGTGTCCCACTAATGGTGCTTGTTTGGACGGCTGTATCTTACATACCAGCCCGTG
ATGTTCCACAAGGGATACCACGGAGGCTTTTCAGCCCCAATCCATGGTCACCTGGAGCTT
ACTCAAATTGGACAGTTATCAAGGAAATGATGCATGTTCCTCCTCTATATATTGTCGGAG
CGTTTATCCCAGCCACAATGATTGCTGTCCTTTACTATTTCGATCACAGTGTTGCATCTC
AACTTTCCCAACAAAAAGAGTTCAATCTAAAGAAACCTTCCTCGTATCATTATGACCTCC
TTCTTTTGGGCTTCTTGGTCATAATATGCGGTCTTCTTGGCATTCCTCCTTCAAATGGAG
TCATTCCACAATCTCCAATGCACACAAAAAGCTTGGCCACTCTGAAACATCAGCTTTTAC
GGAATAAACTTGCATCAACAGCGAGAAAAAACATTGATAAAAATGCAAATCTTGGTCAAT
TATATAGGAGCATGCAGGAAGCTTACAATGAGATGCAGACCCCCCTTGTGTATCAAACTC
CTTCTGGCCTGGGGTTGAAAGAGCTAAAAGAGGCCACAGTTCAACGGGCATCGAGTACCG
GGTACATAGATGCACCAGTTGATGAGACAGTCTTTGATGTGGATAAGGATATTGATGAGC
TCTTACCAGTAGAAGTCAAAGAACAGCGTCTAAGTAATCTCCTTCAGGCGTTAATGGTTG
GTGCTTGTGTGGCTGCTATGCCTATCTTGAAAAGGATTCCTTCTTCTGTTCTCTGGGGAT
ACTTTGCTTTCATGGCAATAGAGAGCTTGCCAGGAAATCAGTTTTGGGAGAGGATATTAT
TGCTTTTCACTGCACCAGGTAGAAGATACAAGGTCTTGGAAGATAATCATGCAACATTTG
TCGAGACGGTACCTTTCAAGACAATTGCCTGGTTCACCTTGTTTCAGACAGTTTATTTGC
TCCTATGTTTCGGCATCACATGGATACCAATAGCTGGTGTTCTTTTTCCTTTGTTGATCA
TGCTTCTAGTCCCAGTGCGCCAGTATTTGCTTCCCAAGTTTTTCAAAGGAGCACATTTAC
AAGATCTAGACGCTGCAGAATATGAAGAAGCCCCTGCAATAGCATACAACATGTCCTATG
GAGATCAAGAACCAGTCTGCATTGATGGTGGTGAGCTTCTTGATGATATGATCACAAGAA
GCCGTGGGGAAATCCGGCGCTCATGCAGCCCAAGAGTAACGAGTTCAACTCCCACCTCCC
TTGAGGAAATCAAGTCAACACACAGCCCACAGCTATCTCAAAGGGCTTATAGTCCAAGAA
TCAATGTACTAAGAGGAGAAAGAAGCCCCATATATGGCAAGGGACTTGAAATAAAGCAAA
CTCCCAGCCCTCAGCCATCTAAACTTGGTCAAAATGATCGCGGTCCGTCTTCCACCTAGT
ATTAACAAATATTGTTGTGAAATTAGAGTCTCTAGTTGTTCTCGAGAGGTCTTGTCTAAG
TCTAAGTAATGTGATTAATCTTTTCCTAGGCATCTGTGTTTCCTTGTTTGTGTGTCTTAC
TGGTCTTTAACAATGTATACTGTTTTATTTGTGTTGTATTCTTGTATGCAAATCAAAATA
CTCTGGGCAGAGGATAGACAAACCATTATATCAATGAATAAAAGAGTGAAAATTTTCTCA
AGTACAGCTGCTTTTGTC