Microarray Probes on PGSC0003DMT400069547

Probe IDChipProbe Sequence
CUST_16593_PI426222305 JHI_St_60k_v1 CACGATTTACGCTAGTTTGTTATTCGAATTTGAGCAGGTCATTATGTATCAACTATGGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069547

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069547 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G17720.1 +2 3e-95 294 166/271 (61%) RNA-binding (RRM/RBD/RNP motifs) family protein | chr4:9862660-9864498 REVERSE LENGTH=313

Transcript Sequence (1425 bp)

>PGSC0003DMT400069547 1425 pgsc_dm_v3.4
AATATCTCTCCCTCAATATTCGTTTGGCCTTATTGGAAACAAACATTTGCCAACTTTTGC
GTACAACACGTTCTATTTCTAACTCCTCCATCTTTTACCCCTTTTGGATTCTTCCTCCAA
TTTTGTTTCCTTCTATTCTTCTCTGATTAATCTGCTATTTTTTTAATCTCGATCGATGAC
GGTTAAAACAGTGCAAGTGAACAATGTTTCTTTGGGTGCTAAAGAGCAAGATATCAAGGA
GTTCTTCTCCTTCTCTGGGGATATTGAATATTTAGAGATGAAAGGTGAGAGTGAGCGATC
ACAAGTTGCTTATGTAACATTCAAGGATCCTCAGAGTGCAGAGACTGCAGTTCTTCTTTC
AGGAGCTACAATTGTTGATCAGTCCATCTCAATAGTCCTTGCACCCGAGTACAAGCTCCC
ACCTACAGCTTCAGTATCACCAGTTCCAACTGAAAGCACCAATGCACCCGCTGCTGGATC
TGCTATTCAAAAGGCAGAGGACGTCGTCAGCAGCATGTTGGCAAAGGGCTTTATCTTGGG
CAAGGATGCAGTTGGCAAAGCCAAGGCACTAGACGAGAGACACAAGATCACATCCACTAC
CTCAGCCACAGTTGCTTCTTTAGACCAAAAATATGGCCTTAGTGAGAAAATAACTACAGG
AGCAACCATTGTGAACCACAAAGTGAAAGAAATGGACCAGAAATTCCAAGTCTCGGAAAA
GTCAAAATCTGCTTTTGCAGCTGCTGAGCAGACAGTTAGCAATGCTGGATCCGCCATCAT
GAAGAACAGATATGCTTTGACAGGGGTAACTTGGGCTGCAGGTGCCTTAAGTCGAGTCAC
TAAGGCTGCCGGGGAAGTGGGACAGAAGACAAAGGAAAAACTGGCTGAAGAAGAAAGAAG
AACTTTTACTAAAGGTCATGCACAAGAAAATACTGCAACTTCATCAAAAGGTAATGTGCA
ACAACAAGCTGCAGATTCCGCTAAAGGTGATGTCCAAGAACTTGCTGCAGCTTCTGCTAA
AGGTGATGTGCAAGAACTTGCTGCAGCTTCTGCTAAAGGTCATGTGCAAGAACATGCTGC
AACTTCTGCTAAAAGTGATGTGCAAGAAGTTGCAGCAACTTCTGCAAAACAAGAACATCC
CGAGTCCCAAACCGGAATTGAGGAATCTACCAATCTCTCTCTTCCACCAAAAGCTTAATC
CAACATTATCTTGAAAGTAAATGCACGATTTACGCTAGTTTGTTATTCGAATTTGAGCAG
GTCATTATGTATCAACTATGGTATTTATACATGGAATCTTATTTCTTATGTATGTTGGGA
CCTAAAATATGATATAATGAACATCATTCTTGTAGGAGATTTATTTTTTTCTAACAAAAA
AAGGGATTTGCAAGAGATGAGATCAATTACTATTTCAATATTGCA