Microarray Probes on PGSC0003DMT400069546

Probe IDChipProbe Sequence
CUST_16659_PI426222305 JHI_St_60k_v1 CACGATTTACGCTAGTTTGTTATTCGAATTTGAGCAGGTCATTATGTATCAACTATGGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069546

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069546 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G16840.2 +3 3e-56 195 118/207 (57%) binding partner of acd11 1 | chr5:5536042-5538026 FORWARD LENGTH=260

Transcript Sequence (2629 bp)

>PGSC0003DMT400069546 2629 pgsc_dm_v3.4
TAGAATGGGAATATTGAAGTGTCCCTACAGCAAAATTCTGAGAATAGCATTAAGTAGGTT
AGCTCACAGTTTGTGGCTTTGTGCTTTTGTGGTTGTCCTGAATAATTCCATCTATGTGAG
ATAAATTCAGATTCTCTTTCACATTTATGAGATTGCTAAGTTTTCTAGGTTAAGAAAAAA
TGGATACTGCTTATGTTGAGGAACATCAAAGGATCAGCTGCCCTAAGGGGCGACAATTTG
CTTCACGTTTGTACTGTTTCTCTTGGTTAAACTGTCACTTGTAAGCTTGTGAGACCGTTA
ACTGGGGAGCTTTAAGAGCTAATCCATCTATTTACTTGGATAAGTACTTCACACACCACT
GCTGGTTGGTATCTCCTTTTCAATTAGGTTTCTTCACTCGGAGCCTTTTCTTTCTGTAAG
AACAATAGAAGTTCCAAAGTGGTCCCATATAAACTACAGTTGATTCAGTTGATCAGAGTC
GTCACATAACTTTGGTTGTTCCCAACATAGACAAATGTTAGCATTTTTGGCCAACGGGGG
GTGAGGGAGATAAAGTTTCATTCCTCATTTCATATTAATACAAGGAGCTTACGATAAAGA
AATGAACCGTGGGCCTAACTCAATCCAAAAATTAGTTCATGAGGTGGGCAAATAAGTAAA
CAAACAAACTCATCCCTCAACCCAATGTGGGATTCTTCCGTATGAGGTGAGGATTGCTCA
GGACCAAATAAGTAGACAAACAACTCATCCCTCAATCTAACGTGGGGAGCTTCTGTATGA
GCTTCCAGTTTTCACCTCCTTTAAGTGTTTTTCGGTTCGGTAGCATTCATTGTTGTCTGT
ATCTTGACTTGGTGAGTTCTGGATTTTCTCTGTCGTTGTTGATGTTTATTTCTTATTAAT
TTTTTTTTTTGTGCACGGCTAGGTTTCAGTTTGTCTTTCTTCGTTTTTTCCTTGATGTGT
AGGGGAGGGTGGAGAAGGATTATATTAGGCAGATGACAAAAGTGCTTAAAGTCTTGAAGC
TCCCCATTTCTGCCAGAGAATAGTTCAAAGTAGCTAGCGAAATCATAAAAGCCTAGGTCC
ATGTTACTTGTGTGTGGCCTTCTTACTTCAGCATGATGGCTTTAATAGAACGATCAACAT
ACCTCTAGGGGAAATTGCAGTGTGAAAAGTCTTATTGACAATTTTTTTTGTGGATACTCT
CACTGTTTTAGTATTTAATGTCAGATTGCTCAGATGTTACGGAGAGTAAGGGAACTATCC
TATACTTAAAAAGTCAATACTACCATTGTTTCTCTTCTTCTTCAATCCACTTGAAGTCTT
GTAACAGAGATACAGATAAAGTGTATTCTAGCATAAGTATTGTTGGTTGTTCACATAGCT
TAAGTGTTGCTTGATTACAAGGATGAGCTGTTTCCAATTTGTGACTGTTCCTTTACTGCT
CCACTTTTGCGATTGATAAGCTCACTTGGTGTTTTTAGGGAGCTACAATTGTTGATCAGT
CCATCTCAATAGTCCTTGCACCCGAGTACAAGCTCCCACCTACAGCTTCAGTATCACCAG
TTGTATGTATAACTTTATGTTTTAAGCAGACTTTCCGGCTTCATCCATCACATGATTGTC
CATAAATGGTGTACTGTTTATATGTGCAGCCAACTGAAAGCACCAATGCACCCGCTGCTG
GATCTGCTATTCAAAAGGCAGAGGACGTCGTCAGCAGCATGTTGGCAAAGGGCTTTATCT
TGGGCAAGGATGCAGTTGGCAAAGCCAAGGCACTAGACGAGAGACACAAGATCACATCCA
CTACCTCAGCCACAGTTGCTTCTTTAGACCAAAAATATGGCCTTAGTGAGAAAATAACTA
CAGGAGCAACCATTGTGAACCACAAAGTGAAAGAAATGGACCAGAAATTCCAAGTCTCGG
AAAAGTCAAAATCTGCTTTTGCAGCTGCTGAGCAGACAGTTAGCAATGCTGGATCCGCCA
TCATGAAGAACAGATATGCTTTGACAGGGGTAACTTGGGCTGCAGGTGCCTTAAGTCGAG
TCACTAAGGCTGCCGGGGAAGTGGGACAGAAGACAAAGGAAAAACTGGCTGAAGAAGAAA
GAAGAACTTTTACTAAAGGTCATGCACAAGAAAATACTGCAACTTCATCAAAAGGTAATG
TGCAACAACAAGCTGCAGATTCCGCTAAAGGTGATGTCCAAGAACTTGCTGCAGCTTCTG
CTAAAGGTGATGTGCAAGAACTTGCTGCAGCTTCTGCTAAAGGTCATGTGCAAGAACATG
CTGCAACTTCTGCTAAAAGTGATGTGCAAGAAGTTGCAGCAACTTCTGCAAAACAAGAAC
ATCCCGAGTCCCAAACCGGAATTGAGGAATCTACCAATCTCTCTCTTCCACCAAAAGCTT
AATCCAACATTATCTTGAAAGTAAATGCACGATTTACGCTAGTTTGTTATTCGAATTTGA
GCAGGTCATTATGTATCAACTATGGTATTTATACATGGAATCTTATTTCTTATGTATGTT
GGGACCTAAAATATGATATAATGAACATCATTCTTGTAGGAGATTTATTTTTTTCTAACA
AAAAAAGGGATTTGCAAGAGATGAGATCAATTACTATTTCAATATTGCA