Microarray Probes on PGSC0003DMT400069541

Probe IDChipProbe Sequence
CUST_16784_PI426222305 JHI_St_60k_v1 TTTGACGTTCTTGAAGTCATTGGCTGCCGAGGGCTGAATCAAACTAACAACATCTGCTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069541

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069541 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G16090.1 +3 4e-97 315 167/241 (69%) RING/U-box superfamily protein | chr3:5456513-5458694 FORWARD LENGTH=492

Transcript Sequence (2491 bp)

>PGSC0003DMT400069541 2491 pgsc_dm_v3.4
AACTCACATGACTGTTGTATGAATGGATGAAGTCAATTATCATTCTTGGCTTATTCATCA
TTGCTTTTCTGCATATTTTAACTTATATGGTGACAAGGGGTGTGCTTACTTTGAAATGGT
ATATGGTGACAAGGAGTGTGCTTACTTTGAAATGGTTTTTCTACCTGCTGTATGCTGGGA
ATCATGTTAGTTACTCTGGTCAATGTGCTGCTATTGTTTTACCCTAGTGCAGTTTGACCA
TATGGCTGTTTTTGTTTTACCAAGTGCAGTTTCATCATATTATATGTATGCCATATCTAG
CTCCCTAGTGAAGTTTAACCTTATTTCTCAGGTACATGATACTTGCTACAACAACTGTTG
CAACATTTGTAAAATATGTATTCTATGTACGTGACATGCTTATGGACGGACAATGGGAGA
GGAAGGCCGTATATACTTTCTACTTGGAACTTATTCGGGACTTGATCCACTTGACTATGT
ACATGTGCTTCTTCCTCATGATTTTCATCAATTATGGTGTGCCTCTGCATTTGGTTCGGG
AGCTTTATGAGACATTCCGCAACTTCAAGACTCGAGTTGCTGATTACATACGATATCGAA
AAATCACTTCAAATATGAATGATCGTTTTCCAGATGCTACACTGGAAGAGCTCAATGGAG
GTGACACTATCTGCATCATTTGTCGTGAGGAGATGACCACTGCCAAGAAACTTACTTGTG
GACATCTCTTTCATGTCAATTGCCTCCGGTCATGGCTAGAACGTCAGAACACGTGTCCTA
CTTGCAGAGCTCTTGTTGTACCACCTGAAAATGGGACGACTGTTGCTGGATCTGGATATG
CTCAGCAAGGAATGAGTTTAGCAAGCACATCTCGAGGTTCCCAAGCAGACCCTAGGACAA
ACGGTTATGTTAGTCAGCACCAGGCTAGACTCCAAGCTGCAGTTGCTGCTGCTGCAATTT
ATGAGAAGTCCTTTGTTTATCCTTCTGCACCAACACTAAGCCGGTCTCATGGATATGCTC
TATTTCCTCCGTCCTACAGACCAGTCAGTTCTGTCAGCGTGGACTCAGAAAGAGAGAGTG
CTGCAAATGAATGGCCACAGCAACATCAATATGCAAATATGCCTTTTGCTTACTATCCAC
AGACCAGTTTTGGTCCTTTAGGATATCCTGGTGCTAACATGCCTTTTGGAGATAGTTCCT
GGAGTAACCTTAGTACTTCAGATACTCAGCTCGAGGCCCATAGGATATTCTTACAGCAGC
AGTGTGAGGCTCTGCAAAACCAGCTCAAGCTTCTACAGAGTTCAAAGACCCAGAAAGCAG
CAGATGGTGCAAAAGTTTCTGAGAGCAAGGGAAAAGCAATTTCATTAGAGAATGCTCAAA
ATGGACAGGCTGCAGGTGCAGATATTTAAGGAATGATCATCTGTAGATAAAGTGCAGTTG
TAATCATCCAGTTAGAATGGCTGCTGAACAATGGAATTCACCAGAGGATTTGTTGGTTGT
ATTTTCTCTAGTGATCTGGAAATAGTTGTATTGCAGGTGTCAAGAAATCGATGATTTCTT
TCTTCTGCAAGTTCCTTTCTTGATGATCTCGAACTCTTGTATCTCTGCAGAGTTCCAATT
TCACATCTTCATTTAACGGTCCATTAGCAAACTAGGTAAACAGGTACAACAATTTTAGCA
CAAGATATTTTATGTTCAAGTAGGAAACTGAGATGAGGGAAGAACTGAATAAAGTGAGAT
GAAGCCTGATTCATACATTCAAGAAGACTCTGGATCTTCAGCCTTGCTGTCTCCATTCCA
GGGTTGGTGTAAATACCGAGTAGGAGTAAGTTTCTTCCGTTTTCAGGATAACATCTGATA
TCAGTATCAAGTATATGCTGAACCCTCCGGAGTTGACACATTCGATTAGAAAATTAAGCT
GTGTGATCGTGTGACCATTTCATCTCTAGCCTTGAATGCATAATAATAGTAGTGTTCATT
CCTTGAACAGTTGAACTATTAACATACAACACACTTCTATTTGTGCTATCTGTATCATAA
ATCAGTGCCAATTTCAAACCAAAAACTCTGTCGGACATCAGACAGGCTGTTGAATTGGCC
TCCTTACTTCAGCATTGAGAGTAGCTGTAATGTGTACACTGTACAGGCATTGACCAGTAC
TCCAGAAATCGTTTTCGTTTGGTTAGAGATATGCAAGGGAACTTGCCACAAACTGATGCT
TTGAGAAAGCCAATGTTTGTATCTCATTTATTCTGCAGGTTCAGATATCTTATTTGTTGG
AGCAATATATAACTGGATGATTCATCCAGTTTGCACCCAATTTATTACACTTAACTTGCT
GTATATGTGAGTTCCTTAGTTGGTTTAATGGATATTCTATTTGCACTACTAATTCTGGTC
TCATTGCTTCCCAACAGTTCCTCCTTTTCTTTTGACGTTCTTGAAGTCATTGGCTGCCGA
GGGCTGAATCAAACTAACAACATCTGCTTCC