Microarray Probes on PGSC0003DMT400069484

Probe IDChipProbe Sequence
CUST_16606_PI426222305 JHI_St_60k_v1 GTTCAATGTATTGATGAATTTGGTCTGTTCCTCTGTGAATTGAACCTTGTGTATTATTGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069484

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069484 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G26850.1 +3 0.0 630 312/406 (77%) mannose-1-phosphate guanylyltransferase (GDP)s;GDP-galactose:mannose-1-phosphate guanylyltransferases;GDP-galactose:glucose-1-phosphate guanylyltransferases;GDP-galactose:myoinositol-1-phosphate guanylyltransferases;glucose-1-phosphate guanylyltransferase | chr4:13499262-13501145 REVERSE LENGTH=442

Transcript Sequence (2104 bp)

>PGSC0003DMT400069484 2104 pgsc_dm_v3.4
TCCTCCATTATCCCTTCTCCAATTTATTATATAAATACCCACATCTCCCTGCTCTTTCTC
CCTTATCATCAACAACAACAACCAAATTTCTTCTTTTTTTCTTCCACAGTAGCAATCTAT
CAACAAAACAGAGACCCCATTACAAGAATCTTGGAATTTTAGTTTTGGGTTTAAGAGGAA
GGGGTTATTGTATTTGCAGTTTTGAGGGTAAAGCCCAGTTTAACAAGGTGTAGACATCAC
GGCTATACACAAAGTAAACCGCCGACCACTTTTACATGTTCCAGCAGTACGTCGTAAGGG
TTGTGTAACAGCTACTAACCCTGCGCCGCACGGTGGACGTGGCGCTTTGCCCTCTGAAGG
TGGCAGTCCTTCCGACCTCCTCTTCCTTGCCGGCGGCGGTTCTTTCCTCTCCTTCTCCTA
CTAGATATAGTTATACTTACCGTAGATCTCTAGCTTATTACGTACAGTTCTATCTAGTAT
TCTCTTGATTATTCGAAGAAAAACACAAAAAGATGATGCTCAAGATTAAGAGGGTTCCTA
CACTTGTTTCTAACTTTCAAAAGGATGAGGCTGATGAAATTGGTGCTCGTGGTGCTGGTT
GTGGCCGGAATTGCCTCAGGAATTGCTGCCTTCCAGGTTCAAAGCTGCCACTGTATGGTT
TCAAAAATTTGAGCTACGGCAAGTCTGTTGCCGCCGATGAAACAAAGGAATCTCCGATCG
ACTTTCTGGAATCCCTTGTTCTTGGGGAATGGGAGGATCGTCAGCAGAAAGGCCTCTTTC
GCTATGATGTCACTGCTTGCGAAACCAAGGTGATTCCTGGAGAATATGGTTTCGTTGCTC
AACTGAATGAGGGAAGGCACCTCAAGAAGAGGCCAACTGAGTTTCGAGTTGATAAGGTGC
TGCAGCCTTTTGATGGAAGCAAGTTCAACTTCACTAAGGTTGGACAAGAAGAGTTGCTCT
TTCAGTTTGAAGCAAGTGAGGAAGATGAAGTCCAGCTCTATCCAGATGCGCCAATTGATC
CTGAGAAATCTCCAAGTGTCGTTGCCATCAATGTCAGTCCCATTGAGTACGGACACGTGC
TTTTGATCCCTAAGGTCCTTGAATGCCTTCCCCAGAGGATCGACAGGGACAGCTTCCTGC
TTGCACTGCACATGGCTGCCGAAGCAGCAAACCCATACTTCCGATTGGGTTACAACAGTT
TGGGTGCATTTGCCACCATCAACCATCTTCACTTCCAGGCTTATTTCTTGGCTGTGCAAT
TCCCCATTGAGAAGGCCCCAACTCAGAAGATAACCGTCACTGATGCTGGAGTGAAGATAT
CGGAGATGCTTAATTACCCAGTTCGAGGTCTCGTCTTTGAGGGTGGAAATACTTTGGAGG
ATTTGGCCAATGTCGTCTCAGATTCTTGCATTTGTCTGCAAGAGAACAACATCCCTTACA
ATGTCCTAATCTCCGATTCAGGAAAAAGGATATTCCTTCTCCCACAGTGCTATGCAGAGA
AACAAGCTCTTGGAGAGGTCAGCGCTGAACTCCTCGACACCCAAGTCAATCCTGCTGTTT
GGGAGATTAGTGGACACATGGTCTTGAAGAGGAAGGAGGATTATGAGGGTGCAACTGAGG
CAAATGCATGGAGGCTTCTCGCCGAGGTCTCACTCTCTGAAGCAAGGTTCCAAGAAGTGA
CTGCTCTCATCTTTGAAGCTATTAGTCTCAGTGTTGAAGAGAATGAGAACGCCACTGATG
GTTCTCCTGAGGATCTAGATGTCACACCTCCACAGCCCATGGAGGAGATTGATGGTCTCA
ACACCCATAGTACCATGGTTCCCGCCTAGGGGTTTCACGGCCCAGCTCTGGTGTTTATCG
CATGTTATTATTTCATGAATTTCCATCTCTAGCTGCCCTTGTGAAATATCACTAAATAAG
GCAAAACCATGTTCAATGTATTGATGAATTTGGTCTGTTCCTCTGTGAATTGAACCTTGT
GTATTATTGCTTTTTTTCTGGTATAGCCATGTTCTATATATATATATATATATATGTAAT
GTGGGGTTGGTGTGTGAAATGACCTTGGGGTACTATGTATGCTGTTTTTAATTAAGACAA
TACT