Microarray Probes on PGSC0003DMT400069397

Probe IDChipProbe Sequence
CUST_16793_PI426222305 JHI_St_60k_v1 GCATCCATTTGTGACCAACCAAACGATTGCCAGGTTCCCCTTTGCAGACAATTCAAATTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069397

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069397 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G63160.1 +3 3e-136 401 211/329 (64%) BTB and TAZ domain protein 1 | chr5:25333485-25335399 REVERSE LENGTH=365

Transcript Sequence (1462 bp)

>PGSC0003DMT400069397 1462 pgsc_dm_v3.4
CCAAAAACTAAAGGAAACTCTCTGAAAATTCCAATTAATCTGTCCCAGGCAAACGATAAT
CATCAATTCCAAAAGCAACTGTAATCACCATGTCATCCACTAACTTTTCAGGCGATATCG
ATGTATTTTCCGGCGAAATGTCTGAGGTTGATATCCAAATCGTCACCTCCGGCGGCCTCC
GCATTCCGGCGCATTCCGCCGTTCTGGCTGCTGCTTCGGCGGTTCTGGAGAATATACTAG
TTCGGCCGGGAAAGCGGCGGAGCTCCGAGAGAACGATTCGGATTCTTGGCGTGCCGTGCG
ACGCCGTTTCCGTGTTTATCCGGTTTCTCTATTCTTTCAAGTGCACTGAAGAGCAGATGA
AGAGACATGGGATCCATCTGCTAGCACTTTCTCATGTGTACTTGGTACCACAGCTGAAGC
AGAGATGCACTAAGGGATTGGCCGAGCGATTGACGATTGAAAATGCAGTGGATGTGCTTC
AACTTGCGAGACTATGTGATGCACCAGATCTATACCTCAAGAGTATGAAATTTTTGTCTA
GCAATTTCAAGAAAGTTGAGGAGACTGAGGGCTGGAAGTTCCTTCAACATCATGATCCCT
GGCTTGAACTTGAAATTCTACAGTTCATGGATGAGGCAGAGTTGCGGAAGAAGAGGACAA
GGAGACACAAACGGGAGCTGAGCTTGTATTTACAGCTAAGCGAAGCGATGGATTGTTTGG
AGCACATTTGCACAGAAGGATGTACTAGTGTGGGGCCATTAGATAAAGAACCTTCCATCA
AGAGGCAGCCATGTAGCAAGTTTGATACCTGCCAAGGGCTTCAGCTTCTGATTCGACATT
TTGCTACTTGTAAGAGAAGGACCAAAGGAGGTTGTTTACGATGCAAGCGCATGTGGCAGA
TCCTAAGATTACACGCATCCATTTGTGACCAACCAAACGATTGCCAGGTTCCCCTTTGCA
GACAATTCAAATTGAAGGTGCAACAAAAGGGAGATGACGAGCTGTGGAAATCACTTGTTA
GAAAGGTGGTGTCAGCCAGGGCCATGTCTTCTTTATCTCTGCCCAAAAGAAAAAGAGAAG
AGGAACCAAAAATGGACTTAAGCCATCCTCAAGTGATGAACTTTAGGTTGGCAGCTTAGT
GTCAAGTATTTCATATCGTTAGGCAAACTCGATCTTTGTAAATAGACCATCAATGGAATC
TAAGTTAGTTTTTACCATTTCATATTTCCTACTGTAGAGGCCTATTCTATATGTTTATTT
TTTTTTCTGTGTCAGTCCTTTAGTTGATGAAGAGTGTTGTATCAACAAAAGAGTTGTATA
CAAAGTGTATAACTACTGTGTGGTAGTCTGTTTATATCTTCATTTTGTGTAATGAAATTA
GCCATTAGTCATATCACATATGCTTCAAATACTTGTTTTCCGTGTCTTTCTACCATTTTC
TGTACATTCTAATACTCTGGAG