Microarray Probes on PGSC0003DMT400069306

Probe IDChipProbe Sequence
CUST_16496_PI426222305 JHI_St_60k_v1 GTGCATGCTACTATGATGAACAACCTAATAATGTGAAAGTGAAATCTCTTGTGGTATGAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069306

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069306 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G01940.3 +1 2e-131 394 224/402 (56%) C2H2-like zinc finger protein | chr2:432652-434917 FORWARD LENGTH=446

Transcript Sequence (1579 bp)

>PGSC0003DMT400069306 1579 pgsc_dm_v3.4
AAACAAGTCTATGAAGAGAAAAAGCTGAAAGTCTAAAAAGATATCTCTAGAGATCAAAAA
AGCTAGCTTATGATACCTATATAGAAACCCTCTTTAATTTCTCCTTTTCACTAATTTCTA
TACACAATTAAAAATCCATTTTAAGTCATGTTTAATTCTTCATCAGACCCCTTCATGACT
TCCTCAGAGAATAATGGAAACAATTGTATTAACAACAACAAAAGAAAAAGAAGGCCAGCT
GGAACCCCAGATCCAGATGCAGAAGTGGTATCTTTATCACCAAAAACTTTATTAGAATCA
GATAGATACATATGTGAGATCTGTAATCAAGGATTTCAAAGGGATCAAAATTTACAAATG
CATAGAAGAAGGCATAAAGTACCATGGAAATTGCTAAAAAGAGAAACTCCTATTGTTAAA
AAAAGAGTATTTGTTTGTCCAGAGCCAACTTGTCTACATCATGACCCTTGTCATGCTCTT
GGTGATCTTGTTGGTATTAAAAAACACTTCAGGAGGAAACATAGTAATCACAAACAATGG
GTATGTGAGAAATGTAACAAAGGATATGCTGTTCAATCTGATTACAAGGCACATCTCAAA
ACATGTGGAACTCGTGGTCATTCTTGCGATTGCGGTCGCGTATTCTCCAGGGTGGAGAGC
TTCATAGAGCATCAAGACTTATGTAGTTTTGGAAGCCTTCGATCAGAATCACAATCTTTA
ATACAATTACCATCAGCACCTTGCCTTTCTCGTACAGCTTCAAGTCCTAGCCCTTCAAGT
GATCACACAAATAATCTCATCACTACTACTAATACAGTCCCATGGCCTAATTTTATTATG
AAAACTCCAAATGCCATAATAAAAAAACACAATTTAGAGCTCCAACTCTTGACTACTACT
ACTACAACAACATCTCCATCTAGCCCCTTTGATGTCTCCGTATCGTCAAAATCGCGCGAT
GATCATAATCTTCAACTCTCTATTGGTTCATCGGATCTAAGTGAGAAGAATGAGTCGGAG
AATAATAATAATGACACACACAGATCGAGAAATGGTGTAGAGGGGTTGAGGCAGGCGTTA
GCCGAAAAAGTGTACGCGGAAGAGGCGAGAAAGAAAGGGAGGAGAGAAATTGAATTGGCG
GAGGAAGAATTGGGTAATGCAAGGAGAATAAGGAGACAAGCACAAATGGAATTAGAAAAG
GCACAAGTATTGAAGGAAGAAGCAATAAGGAAAATTAATTTTACTCTTTCACAAATCACA
TGTCATGCTTGCAAACAAAAGTTCCAAGGTAAAAGGATAACAACAACAAGTATAGTTCCT
AATTCTCATCATGACCAAAATATTCATCTCAAGTATAGTACTTGCCCAACATCACTACAC
TAGTTGTACTATATTGTATTTCTTCATCTCTACTTTGGATTTATTTTTTTTTGTTACATT
TTTGGGCACTTAAGTTTGTTGTATGAATATAAGTCTAGTGTGGATGGTGCATGCTACTAT
GATGAACAACCTAATAATGTGAAAGTGAAATCTCTTGTGGTATGAAAATTTGTAGGGGTT
CTTGATTTTATTATTTTTT