Microarray Probes on PGSC0003DMT400069229

Probe IDChipProbe Sequence
CUST_16715_PI426222305 JHI_St_60k_v1 GGAAATGCTTGCACTTTTGTTCTATGACTATGAGGTACACGAATAAAACAAGAAACTGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069229

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069229 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G36780.1 +1 2e-173 506 247/482 (51%) UDP-Glycosyltransferase superfamily protein | chr2:15417618-15419108 REVERSE LENGTH=496

Transcript Sequence (1835 bp)

>PGSC0003DMT400069229 1835 pgsc_dm_v3.4
GCGAATATTTACTGCGTTGTAAGGAATATGCCAATGTCTATACTGGACGAAGAGAATACT
TATATAAAAGCACCTTTCTTCTTTCTTCATTTGCAACTAAAAATCATTCAACACTAGACA
TCTTTCAGTTAAGTTCTAACACTAAAAATGGGTTCTGAGTCAAGATTAGAAGAGCTAAAC
TTTGTTTTGATACCATTACTTGCTGTAAGTCACATCATACCCATGATAGACATTGCCAAA
TTGTTAGCACAAAGAGGCGTGATTGTCACTTTAGTCATGACGCCTCTCAATGCTATCCGA
TTTACTGCAGTAATTGATCGCGCCATCGATTCTGGACTCCTCATTCGGGTATTTCATCTC
CGGTTTCCAGCCAAGGAAGCCGGATTGCCAGAGGGATGTGAAAGTGTCGATCTTCTACCA
GGTCTAGATCATAGAAGAAATTTCTTTTCTGCAATTGATATGCTACAAGAACAAGCTGAA
AAATTGCTTCAAGAGATGAAGCCTAAGCCGAGTTGCATTATTTCCGATATGCATATTGCT
TGGACAGCTGAGACAGCTGATAAGTTTCAGATTCCGAGAATTATTTTTGATGGAATGAGT
TGTTTCAATCAATTGTGTATGCATAATTTGTTTATCATGAAGGATCAAAACAGAATCCCC
GAATCAGGGCATTTTGTGATCCCTGATTTGCCTGATAGAATTGAAGTAACTAAAGTACAG
CTACCTGGAGCGTTTAATCCCTCGTCAATTCACGTGCAAGATATTAGAGACAAAATACGA
GCAGCTGAAATAAGTGCCTATGGGGTTTTAATCAATACTTTCGCGGAGTTGGAAGAAAAT
TATGTTGATGAATTCAGAAAACTTAAAAATGGTAGAGTTTGGTGTATTGGGCCTTTGTCT
CTCTGTAACAATGAGAGTCTAGATAAAGCGCAGAGAGGGAATAAGACGTCATTTGACGAA
GAGGACTGTTTGAAGAAATGGCTTGATTCATGGCAGCCTGAGTCTGTTGTGTATGCGTGT
TTGGGAAGCCTTAGTCATACCACAGTAGTACAATTTGTGGAGCTGGCTTTAGGCCTGGAA
GCATCAGGTTATCCATTTATTTTAGTCGTAAAATCAGGGGAAAGACAAGCACCAATAGAG
GATTGGATATCAGAAAGTGGATTTGAAGAAAGAATAAAAGGGAGAGGGCTTTTGATCCGG
GGCTGGGCACCACAAGTAGTAATTCTATCGCACCCTGCAATTGGTGGATTCTTGACTCAT
TGTGGTTGGAATTCGTCCCTGGAGGGGATTAGTGCTGGTGTGCCTATGATCACTTGGCCT
TTATTCGCGGAGCAGTTTTTAAATGAGAGATTCTTAGTACATGTCTTGAAGACGGGCGTG
AGTGTTGGATCTCAGGAAGTTGTGCATTTCGGTGAGGAAGAGAAACATGAATGCCAAGTG
AGCAAAGAAGAAGTGATGAAAGCCATAAAAGAAGTGATGGACAAAGAGAAAGAAGGAAAT
AATAGGAGAATAAGAGCCAAAGAAGTTGGAGAAATGGCAAAAAAAGCTATAGAAGAAGAT
GGATCTTCTCATCTCAGTTTGACACTACTAATCAAAGAAGCACAAGAATTCAACTTAACC
AATTAGCTTAAAATGACTATGCACAAGTATGCAATGTACTTCTTTGATTTTTATGTTTTT
GGTAGCGGAAGGGGAATTGGGGAGGGAAATGCTTGCACTTTTGTTCTATGACTATGAGGT
ACACGAATAAAACAAGAAACTGTTATAGATTAACTTTGCCAGTTTCAACTTTCAACAATG
AGTTATATATAAAGTATAATTAAGTGATTGGTGAC