Microarray Probes on PGSC0003DMT400069218

Probe IDChipProbe Sequence
CUST_16614_PI426222305 JHI_St_60k_v1 GCTACTGATCGATCGAGCAGGCTATCTAATAAATAATGTGTTAGGAGATTTGTACAATAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069218

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069218 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G24530.1 +2 3e-176 502 231/338 (68%) 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein | chr5:8378964-8383154 FORWARD LENGTH=341

Transcript Sequence (1409 bp)

>PGSC0003DMT400069218 1409 pgsc_dm_v3.4
ATTATATATATATCAGCTAGTTTGAGCTTCAATGAAACTACTTGTACATTTCGATCGAGC
AATATTAATATTCTAGTTCTTGCATTACATCTCTATTTTTGTGTTCTTAAACATAATGGA
AACAACAAGTGTTCTTTCCGGTGGATTCAACCACTCAACCCTCCCTGAATCTTACGTTCG
ACCTGAATCCCAAAGACCCCGCATGTCTGAAGTTGTTGATCGTGATGATCTTGTTCCAGT
TATCGATATGTCTTGTACTGATAGGAACGTTATCGTTCATCAAATTGGCGAAGCTTGTCG
CCTTTATGGGTTTTTCCAGGTGATAAATCACGGTGTATCAAAGAAGGTTATGGATGAAAT
GTTGGGGGTAGCTCATGAATTTTTTAAGCTTCCAGTGGAAGAAAAGATGAAATTGTACTC
AGATGATCCATCAAAGACTATGAGATTATCAACTAGTTTTAATGTTAAGAAGGAAACTGT
TCATAATTGGAGAGATTATCTTAGGCTACACTGTTATCCTTTGGACAAATATGCCCCTGA
ATGGCCTTCTAATCCTCCTTCTTTCAGGGAAATAGTGAGCAAATATTGCATGGAAGTTAG
ACAAGTTGGATATAGATTAGAAGAAGCAATATCAGAGAGCCTAGGGCTCGAGAAAGATTG
TATTAAAAATGTGTTGGGTGAACAAGGACAACATATGGCTATCAATTTTTATCCTCCATG
TCCACAACCTGAACTAACTTATGGGTTACCAGCCCATACAGATCCAAATGCAATTACAAT
TCTTCTTCAAGATTTGCAAGTGGCTGGCCTTCAAGTTCTTAAGGATGGAGAATGGTTATC
TATTAAACCTCAACCTGATGCCTTTGTCATCAATCTTGGTGATCAATTGGAGGCATTGAG
TAATGGAAAGTATAAAAGTATATGGCATAGAGCTATTGTAAATTCAGATAAAGCAAGGAT
GTCTGTGGCTTCTTTCCTCTGTCCCAATGATTGTTCCATTATCAGTGCTCCAAAAACCTT
AATTGAAGATGGATCTTCAGCCATTTATCGAGATTTCACTTATACTGAATATTATGACAA
ATTTTGGAGCAGGAATTTAGACCAGGAATATTGTTTAGAACTTTTCAAGAACGATGGAAC
CTAGTACTTGTATGAGTTCGAAGTAATTATTTATAACTTTTGTATCTACCTAAGTGTGGT
TATCACACAGTTACCGTTCCATCGGGTCATCTAATAAATATGTTAGGAAATTAATCAAAT
TATACATCGACAGTATAAAGAATTTTTATATTTGTCCATATGTGTGATTTTGTAACGAAG
CTACTGATCGATCGAGCAGGCTATCTAATAAATAATGTGTTAGGAGATTTGTACAATAAT
TTACCTTTGCAAAAGTTCCATCGTCTCTT