Microarray Probes on PGSC0003DMT400069193

Probe IDChipProbe Sequence
CUST_16564_PI426222305 JHI_St_60k_v1 GGTCCAACTTTAGTCTATCTATGTCTTTCGTTGGTTTTAACATCGAAATTCTACAGCATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069193

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069193 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G09340.1 +2 4e-38 145 67/80 (84%) chloroplast RNA binding | chr1:3015473-3018035 FORWARD LENGTH=378

Transcript Sequence (1852 bp)

>PGSC0003DMT400069193 1852 pgsc_dm_v3.4
TTAGACTGGAGGCACTTACAAAATTCTTATTATTGAACCTTGTCTGCTGGCAGAGAGATT
AGACTTCATAGTTTGTTTATCTCTGAGGTGTAACAAATAGCAGCTTATCTGCTCGGTCCT
ATTTGCACCTTGCTTCAGCCTTTCTTCTAATTTTTGGTCTTATCTTGTCCCTTATTCTTT
ATGTAGTTGTTTTCTCCAAGGCTAACAAAAACATCTTGCCCAATGTCAACAGGTTGATGC
AGGTGACCCGAAGAGCAGGCATAAAGGAAAGCTTGAGACAGAGAGCTTGTTAGTATCACG
AGATGTTAATTGGACTTCTCTAAGGCCTGTTTATATTTATGGGCCACTTAACTACAATCC
TGTTGAAGAGTGGTTCTTCCACCGATTGAAAGCTGGTCGCCCAATTCCAATTCCTAACTC
AGGGATGCAAATAACTCAACTTGGACATGTGAAGGTTAGTCAGCACATATTAAAAGAGTA
GTTCACATCTTTCTAGTGTAAGCTTCAAGCAATGCTATCACCCTAGAAGTTCAACGGAGA
CATGTTTGCTTAGGTCCTCTAGGTATTCAATCTTCGCAAGTGGCCTCCATTTAGTAAAGA
CCAGGAAATATGTCTTTTCAAGTAGGAGCAATGTACTCTTGGTCTACTTTCAGGCAATAC
TCGAGTTAAACAGCATTATAACATAATGAGCTTAGTAATCGTCTCAAATAAGAATCACAA
CCCTGTGTCTACGTGATAATATTTTTGCTTTTGGTTGATATTGGCAGGATCTTGCAAAGG
CTTTTGTTCAGGTTCTTGGAAATGAGAAAGCAAGCAAGCAAGTATTTAACATATCCGGAG
AGAAATATGTCACATTTGATGGATTAGCTAAGGCTTGCGCCAAGGTAATTTTTTTTGGTC
AATGTTAGCTTATATTGCTTCTAAAAGCTTTGAATGATGTACAATTGACTGTCAATATTC
CTAATCCAGGCTGGTGGTTTCCCTGAACCCGAGCTTGTTCATTACAACCCTAAAGAGTTC
GATTTTGGCAAGAAGAAAGCATTCCCATTCCGTGACCAGGTAAACATTAGTGTGTTGATT
TCAGTTTTTTACCATTCATATTGAAATTTGAGACATTCTTTATCAAAGAATCAAAATGAT
ATAACCAAACTAAATGTGAATCATCAGTAAAGGTTCACAACATGTTCACCGCGTCTTTTC
TTAGTCTCTTCCTAAAACACACATCAGTATTCTACATGAGTTTGTGTGCTTGAATAAAAC
ACACATTTTAGTACAATCAATCGTAGTCCAAACGAAATACTACGAGAAGGTTTATTTCCT
TGGTTGAAGTTGTTAGTAGTCTGTTTAATATCGGATTCTGGTCCAACTTTAGTCTATCTA
TGTCTTTCGTTGGTTTTAACATCGAAATTCTACAGCATTTCTTTACATCAATCGAAAAGT
CAAAGGCTCTGCTAGGATGGAAACCGGATTTTGATCTGGTGGAAGGTCTTACAGACTCTT
ACAACCTAGATTTCGGACGGGGAACATTCAGGAAAGCAGCTGATTTCTCTACAGATGATA
TGATTCTTGAAAAGAAACTAGTTCCCCAGAGCTAGGATTTCCTGTTTTTCATTTTATAAG
TTTTGGTTTCTTACTTTTCCTCCAAGAAGTTCACAAGTCTTTAGTGGCCAAACTATTTGA
AATTTTCCTTGTATATTAACTTCACTGAGATGAAATGAATAACAAGTATTGTCATGTTGC
CATAAACATTTTGTTGGGGAGGGGGTATAGTGTCGCGGTTGTATAAACTATGCGAAGTTG
AATAAAATATTTTGGTCAAAAAATGTCCTTGCCGTTAATAGTTTGATTAAAA