Microarray Probes on PGSC0003DMT400069191

Probe IDChipProbe Sequence
CUST_16819_PI426222305 JHI_St_60k_v1 GCGGTTGTATAAACTATGCGAAGTTGAATAAAATATTTTGGTCAAAAAATGTCCTTGCCG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069191

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069191 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G09340.1 +1 0.0 649 315/378 (83%) chloroplast RNA binding | chr1:3015473-3018035 FORWARD LENGTH=378

Transcript Sequence (1584 bp)

>PGSC0003DMT400069191 1584 pgsc_dm_v3.4
GAGGGATTCTAAGTGGGGTCTCTGTCTTATCTCAATTGTAAGAATGAGAGGAAGCCAGAA
CAAATCATAATCACTAGAAGAAGAAGAACAAATGGACAACAAGAAAATCATCATAGCCCT
TCTCCTTCTTCTTTATTCTCTGCCCCAATTTCTTCTTCACACTGAGGAAGGAAAAGGCAA
CAAATCAGCAACAATATGGCTAGTTTGGTTGCTATTCAACCCAAACAGCCTTCTTTCTCT
GTTCTCCCTTCTTCCCATTCTGACTTCAATGGTGCCAGATTGATCTCCTCATTTCAGTAT
AAGAGGAAACCATGCCTGTCAAAAGGAGCATTGCAAGTTACAGCCTCGAGTGAAAAGAAA
ATCCTTATAATGGGAGGCACACGATTCATTGGTGTGTTTCTATCCAGACTTCTTGTGAAA
GAAGGCCACCAGGTTACTCTATTCACAAGAGGAAAAGCTCCAATATCTCAACAATTACCA
GGTGAATCAGACCAGGATTATGCTGATTTCTCCTCTAAGTTATTGCACTTGAAGGGTGAC
AGAATGGATTTCGATTTTGTGAAGAGTAGTCTTTCTGCAGAGGGCTATGATGTTGTATAT
GACATAAATGGACGTGAAGCAACTGAAGTGGAGCCAATATTGGATGCATTACCTAATCTA
GAACAGTACATATACTGCTCTTCAGCTGGTGTATACCTTAAAACTGATTATTTACCACAT
TTTGAGGTTGATGCAGGTGACCCGAAGAGCAGGCATAAAGGAAAGCTTGAGACAGAGAGC
TTGTTAGTATCACGAGATGTTAATTGGACTTCTCTAAGGCCTGTTTATATTTATGGGCCA
CTTAACTACAATCCTGTTGAAGAGTGGTTCTTCCACCGATTGAAAGCTGGTCGCCCAATT
CCAATTCCTAACTCAGGGATGCAAATAACTCAACTTGGACATGTGAAGGATCTTGCAAAG
GCTTTTGTTCAGGTTCTTGGAAATGAGAAAGCAAGCAAGCAAGTATTTAACATATCCGGA
GAGAAATATGTCACATTTGATGGATTAGCTAAGGCTTGCGCCAAGGCTGGTGGTTTCCCT
GAACCCGAGCTTGTTCATTACAACCCTAAAGAGTTCGATTTTGGCAAGAAGAAAGCATTC
CCATTCCGTGACCAGCATTTCTTTACATCAATCGAAAAGTCAAAGGCTCTGCTAGGATGG
AAACCGGATTTTGATCTGGTGGAAGGTCTTACAGACTCTTACAACCTAGATTTCGGACGG
GGAACATTCAGGAAAGCAGCTGATTTCTCTACAGATGATATGATTCTTGAAAAGAAACTA
GTTCCCCAGAGCTAGGATTTCCTGTTTTTCATTTTATAAGTTTTGGTTTCTTACTTTTCC
TCCAAGAAGTTCACAAGTCTTTAGTGGCCAAACTATTTGAAATTTTCCTTGTATATTAAC
TTCACTGAGATGAAATGAATAACAAGTATTGTCATGTTGCCATAAACATTTTGTTGGGGA
GGGGGTATAGTGTCGCGGTTGTATAAACTATGCGAAGTTGAATAAAATATTTTGGTCAAA
AAATGTCCTTGCCGTTAATAGTTT