Microarray Probes on PGSC0003DMT400068830

Probe IDChipProbe Sequence
CUST_16858_PI426222305 JHI_St_60k_v1 TTGATCATTGATATTTCTGAGACCATGAGTTACACGGGTTCTCTTTACTTGGATGTTGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400068830

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400068830 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G39800.1 +3 4e-77 251 122/167 (73%) delta1-pyrroline-5-carboxylate synthase 1 | chr2:16598516-16602939 REVERSE LENGTH=717

Transcript Sequence (891 bp)

>PGSC0003DMT400068830 891 pgsc_dm_v3.4
TAGAAAGTTATCACTCATCTCTTTTATTCTACTACTCACTATATACTACTACTAGGTAAA
CCCAAGCAGCAGCAGCCAGCCAGCCAGCAGAAACATAGGAGTATTCTTTAACAATGGATT
CCGCTGATCCTGCTCGGGCATTTGTAAAGGATGTCAAACGAATCATTATTAAGGTTGGAA
CTGCCGTGGTTACCCGAGGTGATGGAAGATTAGCACTTGGAAGAATGGGATCACTGTGTG
AGCAGATTCGGGAACTTACCTCTCAAGGCTTTGAAGTTATTTTGGTCACCTCAGGTGCTG
TTGGTGTTGGCCGTCAGCGCCTTAGATATAGGAAGCTCATTAACAGCAGCTTTGCGGACC
TTCAAAAGCCTCAAGGTGATCTTGATGGCAAGGCTTGTGCGGCTGTAGGTCAGAATGGCC
TCATGGCTCTGTATGATACGTTGTTCAGTCAGTTGGATGTAACCTCAGCTCAGCTTATGG
TGACTGATAATGACTTTAGAGATCCAGATTTTAGGAGACAACTCAATGAAACTGTAAACT
CATTGCTCTGTCTAAAAGTTGTACCTATATTTAATGAGAACGATGCTATCAGCACACGGA
AAGCTCCTTATGAGGTATCATTTCTCTTGTTTTTTATACTCTACTTGCTGTAGCTGGTGC
TTCCTGTAAGAGTTCCTTCGCTAATAGTTCAATAATTATGTTTATGAAAATAAAACAGGC
TTGCTAACTTGTGTATAGGACCGACCAACCAAGAGTGCAACTCTTAAATTCTTGAGAAAT
GTTTATGCAGCTGTTTCAAATATGGATCCTTTGGAACCTGCTTGATCATTGATATTTCTG
AGACCATGAGTTACACGGGTTCTCTTTACTTGGATGTTGTTTTTTAACTTC