Microarray Probes on PGSC0003DMT400068342

Probe IDChipProbe Sequence
CUST_20450_PI426222305 JHI_St_60k_v1 CAACAAAAAGCATTGCTCAATCAACAGTTGGAGCAACTTGGTTCAATTACTAATTCCCCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400068342

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400068342 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G40435.1 +1 3e-30 110 64/124 (52%) BEST Arabidopsis thaliana protein match is: transcription regulators (TAIR:AT3G56220.1); Has 289 Blast hits to 289 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 289; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:16887048-16888407 FORWARD LENGTH=158

Transcript Sequence (531 bp)

>PGSC0003DMT400068342 531 pgsc_dm_v3.4
ATGGGATCCAAAGAGCAACAAAAAGCATTGCTCAATCAACAGTTGGAGCAACTTGGTTCA
ATTACTAATTCCCCTTCTGTGAATAAGACATCAATCATTGCCCATGCATCAAAGTATATA
GAAGAATTAAAGGAAAGGATTGACAAGTTAAATGAAGATGTTTCAACTTCACAACCTTCT
CATCATGACCATGAAGATGCCTTGCCAGAGGTTACCGTAGAAACCCTAGAGAAGGGATTC
ATAATAAATGTGTTTTCAGAAAAGAATTGCCCTGGTTTGCTAGTCTCAATATTGGAAGTC
TTTGAAGAGCTTGGCCTTGAATTATTGGATGCTAGGGTTTCTTGTTCAGATTGTTTTCGA
CTTGAAGCTGTTAGTGATGTAAGAATTTCTATTTCTCTATTTAATTTACTTCCTCTTCTA
CATTTTATTTTTATTTTTAAATTTAAATATCTTTTTTTTTCTTGTTTGTGGAAAATAGAA
TATTTTCTTTATTTTTTAACTGCGTCTCATTTTAAATTTCTTTTTTATTAA