Microarray Probes on PGSC0003DMT400068328

Probe IDChipProbe Sequence
CUST_47852_PI426222305 JHI_St_60k_v1 GGTGCCATGATTTTCATTCAGCAGTTTGTATCAAATGTTTTTCTACTGTGGTAAAGTCAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400068328

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400068328 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G60920.1 +2 0.0 735 326/406 (80%) COBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family | chr5:24511466-24513932 REVERSE LENGTH=456

Transcript Sequence (1877 bp)

>PGSC0003DMT400068328 1877 pgsc_dm_v3.4
CTTCAATAAGCCATGTGAGCTCACTTCCAGCTGCCACTCACCGCCAAGATTTTTCTCCTC
TTTTACTCTCATTTTCTGTACCATTTTAGCAGATCTTGAACAGTCATTGGCTAAAAAACC
CTCAAGAAAATCTGCAGCAGCTACAGAGGGGTCTATGGAGTTCTTCAGATCTACCATATT
ATTAGTCTTCTTGCTGTCATGCTTCAGCTTTTCAGCAACAGATGCCTTCGATGCACTTGA
TCCCAATGGGAACATCACAATTAAATGGGATGTCATCAGCTGGTCACCTGATGGATATGT
TGCTGTTGTGACTATGTTCAACTTCCAACAATATAGACATATTCAAGCACCTGGTTGGAC
GTTGGGATGGACATGGGCGAAGAAGGAGGTGATATGGGGCATGGTGGGAGCTCAAACAAC
AGAGCAAGGAGATTGTTCAAAATTTAAAGGAAACATTCCCCATTGCTGCAAGAGGGATCC
AACCGTCATCGATTTACTACCCGGAACTCCTTACAATCAGCAGATTGCAAATTGCTGCAA
GGGAGGAGTGATCAACTCATGGGGACAAGATCCTGAAACTGCCGTTAGCTCATTCCAAGT
CAGTGTTGGTTCAGCAGGAACAACGAATAAAACAGTTAGAGTTCCTAAGAACTTCACCCT
TAAGGCACCAGGGCCTGGTTATACTTGTGGACCCGCTAAAGTTGTTAAACCCACTAAGTT
CTTTACTAATGATGGGAGACGAGTAACACAAGCCATGATGACCTGGAATATCACATGCAC
ATACTCACAGTTCCTAGCTCAAAAAACTCCTACATGCTGTGTCTCCCTTTCATCCTTCTA
CAATGACACCATTGTACCGTGCCCAACATGCACTTGTGGCTGCCAGAAGAATGGCACTCA
GCATGGAAATTGTGTAGATCAAGACGAACCACACTTAGCTTCAGTTGTTTCAGGCCTTGG
AAAAAACAATTATGCTCCTTTGGTTCAGTGCACAAGTCATATGTGCCCTATTAGAATTCA
CTGGCATGTGAAACTCAACTACAAGGAGTATTGGAGGGTGAAGGTCACTATAACTAACTT
CAATTACAATATGAATTATACGCAATGGAACTTAGTTGTCCAGCATCCCAACTTTGACAA
CCTCACTCAGTTATTCAGCTTTCATTACAAGTCATTAACTCCTTATGGAGCAATAAATGA
CACTGCTATGCTCTGGGGTATGAAATTCTACAACGATCTGCTCATGCAAGCTGGTCCACT
AGGAAATGTCCAGTCTGAGCTGCTATTCCGCAAGGATATGTCGACTTTCACTTTTGAGAA
GGGGTGGGCTTTTCCACACAGAGTTTATTTCAATGGTGATAATTGTGTCATGCCACAACC
TGACTCATATCCATATATGCCAAATACTGGTACTGTATGGAAGTTTTCTTCGTTAAAGCT
AGTGGTGATGTTGATGCTCTCTACGGCATTCTTCTTTGCAACTGTCTAGAAACCGGATAC
ACACCAAGTTCCTGTCTCAGTAAGTTATCTTTGGGTTGATTCGCTTGCACAGCCGAGGAA
AACTGATTGGAGAGTTAGATGTCTGAGCAGAGTGATGCTGACCATTTTTATGGATTCGGG
TATATGCTTGTTGAAGACGAATTTTAATTTCCTCTATATGCTGTTTGAAGGGCTAGTGAA
AATGGTGCCATGATTTTCATTCAGCAGTTTGTATCAAATGTTTTTCTACTGTGGTAAAGT
CATTTTTGTTATGTAGATTTTCTTAAGTTCACAGTTATATCAGGGTTGTATGAGAATAAA
GACTATTCAGAAACAGATAGAGTTAATTATATGATATTCTTTAGTTCTCTTATTTTTACA
CAGTATCACCATGTAAC