Microarray Probes on PGSC0003DMT400068085

Probe IDChipProbe Sequence
CUST_17525_PI426222305 JHI_St_60k_v1 GATTCGACTGGTCATAAGACGCAGGAGGCAGACTCTAATGGTCATATAGTGGACAATTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400068085

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400068085 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G16760.1 +1 6e-63 201 100/179 (56%) Inositol 1,3,4-trisphosphate 5/6-kinase family protein | chr5:5509890-5510849 FORWARD LENGTH=319

Transcript Sequence (627 bp)

>PGSC0003DMT400068085 627 pgsc_dm_v3.4
ATGAAATTTCCCCTGATTGCAAAGGCGGTGATTGCTAATGCTACAGCTGACGCTCATCAG
ATGTCTCTAGTGTTGAATGGCGACGGATTAAACGGAATTAAAACCCCAATCGTATTACAG
GAATTTGTAAACCACGGGGGAGTGATTTTCAAGGTTTATGTAGCAGGGGATCATGTGAAA
TGCGTGAAGAGGAAGTCGTTGGGTGATATAACCGAAGAGAAATTGGGGAATTCGGAGAAT
TTGATTCCGTTTTCACTGATTTCTTACTTCGCTGATAATGACCAGAGCGATGAGAGTTTA
GCGAAGCTGATGGAGGCAGCAGTTATGCCTCCATCAAGCTTCGTTAACGAAGTTTCAAAG
CAGTTACGACGTGCTTTGAAACTTCATCTTTTCAATTTTGACATGATAAGAGATAGTAGA
GATGGAAATCGGTATCTAATTATTGATATCAATTATTTCCCTGGTTATGCTAAAGTGCCT
GAATATGAACAAATGCTGACTCCCTGTTTTCTTGATTTAGCTCACCAGAAGCGCAGCAAA
GAGACTGCTAATATTGACCATGAGGCAGATTCGACTGGTCATAAGACGCAGGAGGCAGAC
TCTAATGGTCATATAGTGGACAATTAA