Microarray Probes on PGSC0003DMT400067827

Probe IDChipProbe Sequence
CUST_33677_PI426222305 JHI_St_60k_v1 GCTTTCTTTGTAAAGTCACGTGATTGCGGAACTAAGCAATGTTAAAATATTCATTGCAGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400067827

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400067827 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G38200.1 +2 0.0 522 261/342 (76%) Class I glutamine amidotransferase-like superfamily protein | chr5:15256383-15258474 FORWARD LENGTH=436

Transcript Sequence (1694 bp)

>PGSC0003DMT400067827 1694 pgsc_dm_v3.4
ATTCAACTTTGTGTGTCTCATTCTTCGCCCCTTAAATAGCTCTCTTTATCTAAATTAAAT
TCTCATCTCTTTTAGTATTTGCATTTTAGCTACTACTCATAAGTAGTTGCAAAAAGAAAA
AAAGAAAAAATTAAAGCAAAATTATCGTGCTGCCATGGCTGTCGAGGAGCTCTCAGTTGT
TCTCCCCCGCGTGCTCATCGTCTCTAGACGTACCGTTCGTAAGAACAAATTTGTTGATTT
TGTTGGAGAATATCATCTCGATCTTATAGTAAGCTATGGAGCTGTTCCGGTGATTGTACC
CAGAGTTTCCGGGGTACATATGTTATTAGACAGTTTTGAACCAATTCATGGTGTTCTTCT
CTGTGAAGGAGAGGATATCGATCCTTCTCTGTACAACGATGAACTATCCAATCTCTCCGT
CGAAGAATTGGAAGAAATTAGGAGATTGCACGCTAGCGATACTGCAATTGACAAGGAAAA
AGACACAATTGAACTCAGATTGGCTAAGCTCTGTCTAGAAAGGAACATTCCCTATTTGGG
AATATGCAGGGGTTCACAGGTACTAAATGTTGCATGTGGGGGAACTCTTATACAAGACAT
CGGAAAAGAAATATCGAAAAACCTTCCTGAGAGTCAGAGGGTAGTTCACATGGATTATGA
TAACTATGATGGTCATAGGCATGTTATAGAAGTTGTTGAGGAAACGCCATTGCACCATTG
GTTCAAGGATTCGTTGGAAGACGAAAAAATGGAGATTTCAGTCAATAGTTATCATCATCA
AGGAGTTAAAAAATTGGCTCAGAGATTTGTTCCTATGGCATTTGCCCCTGATGGTTTAGT
TGAAGGATTTTATGATCCGGATGCTTATAATCCTGCCGAGGGTAAGTTTATTATGGGACT
TCAATTTCATCCGGAACGAATGAGGCAAGAAGATAGTGATGAATTTGATTATCCCGGATG
TACATTTGCTTATCAGGAGTTTGTGAAGGCTGTAGTTGCATATCAGAAAAAACTGTTAAG
CACAACCACAATCCAAAAGCCATTGAAGCTTAATCAAGAAATGGAGAAGAAGAGGAAAAT
TATAGTTAGAAGTTTTTCCCTTGCCAGAGATTTATACGAAAAAGGCCGTACATTTCAGCC
ATCTAAAACTTCAGACTTAGATGTAGGAGCAGAATTCCTCGAGGTACATGAATAATTCTC
ACTTACGTGCTATAAGACCATACTTATTTTGAACCTACTGACTCTATCGATTGAATTAAC
GATGATAATTATATATGTTATGTTTGCAGTCAAATACAGCATTGAGTTTGCAACAAGAGA
CGAGGTTAATGCAAATGGGAGCAACAGTAAGGAATGCATCATCTTATTTGCAGAGATTAA
AGATGAATGAAGAGAAAGAAAGGTTGGCAAGGAAAGTAATGGGGAAAATGTCAGTGGAAC
AGCTATCTGATCTGAAAACATTTTACAATATGATGGGACAGATATCTTCAGAAGTTTTGG
AGAGAAAATTACAGGATCTCATGATTCTTGATGAGGAATTTTGATATTTCTGCACGAGTT
TTTTTTGCTTTAATTTAAATTTTTTTCTTGTCAAGCTTATGTAATTGCTTTCTTTGTAAA
GTCACGTGATTGCGGAACTAAGCAATGTTAAAATATTCATTGCAGTTTTTTAGCATAAAA
TAGTTATAATAACA