Microarray Probes on PGSC0003DMT400067168

Probe IDChipProbe Sequence
CUST_26934_PI426222305 JHI_St_60k_v1 GCCCTGTCTACATATAGGTTAGGTAAGTGTTACAATTTCGTCTTCATTAATGCATAGTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400067168

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400067168 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G71970.1 +1 7e-24 99 69/170 (41%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22680.1); Has 58 Blast hits to 58 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | chr1:27093099-27093776 FORWARD LENGTH=225

Transcript Sequence (1176 bp)

>PGSC0003DMT400067168 1176 pgsc_dm_v3.4
CAAGGAGAGAGTAAAGATACCAAAGACTAGGCAACAACATATCTTCCTCTTCCACTTTTC
ATTTTCTCCCTTCATCAAGAATCAATGGCTTCTACTCTTACTACTCCAACTCCAACTCCA
ACAAATGATGTTGATGATCATCAAAGTCATGACACCACATTCTCAACCCCATTTTTCCGG
CCACCACCACCGACGACTCGCCGGAGTACTCCATCATCTCTCTCTTCATCTCCATCTCAC
TCTTCCAACTCTTCCTTTGGATCATCACTCTCTTTCCATGATATTCTTGATGATCATAAT
TCCCCTATTAGCCCTACAACTCCTCTTCAATTCCCAAAAGGTGTACCCTTTTCTTGGGAA
AAAATTCCTGGAATTCCAAAACAAATATTTTCCAAGAAAAATAACACTACTACTACTCTA
GGTCAACTTCTCCCATTAATGCCACCACCATGTGGAAATGGAAATAATGTTCCAAATAAT
TCATCCAAGAAAATTACTAGTTTTCTTGATGAGTTTTCTCCAAGAAAAAATGTTGCTAAA
AGTTTTAGAAAAGATCCATTTTTTGCTGCATTTGTGGAGTGTTCCAAAGATGATCAACAA
CAATATGATGATGACATTTGGAAAAATTCTTCAAAGGTACCATCAATAAGAAGTTTAAGT
GATAGATTTGGATTCATTAGCATGTATACTTCATGCAAAAGAACTTGTACAGTCTCTGAA
TCCATTGTTTATCTTCCAAGATCAAGAAATAATTATAGTAGGAAGTACTAGTGATCATGA
GTCAATAAAGTCCTAGATCGACAGACAGGCAGATGCAGAGTCAAGATTTGAAGTTTATCA
GTTCTAAAGTGAATCTATTGCTCGTTTTAGTTATGGGGTTCACAATTATTAATGAATTTC
CCAGTACAAATACAGGGTCTAAGCAAAAGCTAGTGAGTTTATTAGAATATGCATGCCACT
AATATTGTAGCTCTGGCCCTGTCTACATATAGGTTAGGTAAGTGTTACAATTTCGTCTTC
ATTAATGCATAGTTATTTTCATGAAATTGTAACCTATGCTTTCGGTTTTTATTTTATTTT
TCATATTGTAATTTTTCATTTGTGGATTTTATGTAATGCAACGTGAGGACAAGTCAATGT
GTTTGTCCAAAATTAATTAATACTAGTACAATTATG