Microarray Probes on PGSC0003DMT400067020

Probe IDChipProbe Sequence
CUST_17718_PI426222305 JHI_St_60k_v1 TGCCACCCGTCAGAGTCATCATTGGTAGAATATACCTCTTCAAAGAAGAGAAAATTATAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400067020

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400067020 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G44840.1 +1 1e-42 145 72/107 (67%) ethylene-responsive element binding factor 13 | chr2:18495440-18496120 FORWARD LENGTH=226

Transcript Sequence (609 bp)

>PGSC0003DMT400067020 609 pgsc_dm_v3.4
ATGTACCAACAAAAAACAACAACCATTTCAGATTCTGATCTTTCCGTCCTTGAAAACATC
AAATTCCATCTTGTTAATGATTCTGATTTTTCTCAAATCCTTTCAATGTTCGATCCGATA
AATATTAGTTATGCAGATATTATTAATAGCCCGAATTCGAGTTATGGTAGCTCTACATCA
GCAGCAGAGATTAGTTGGGGAGATATGATAACTAATATTGATAATCCATGGCAACGTGTC
GATAAATTGGAGCATGAGGAGGAACCAAAAGAGGAGCCTATAGTTGCACGTGGTGTGCAC
GCGCCTGGTGATTGGAACCGGTATAGAGGCGTCAGGCGGCGGCCGTGGGGTAAGTTCGCG
GCGGAGATAAGAGACCCGGATAGAAAAGGTGCTAGGCTTTGGCTAGGGACTTACGAGACA
CCTGAAGATGCAGCATTGGCGTATGACCAAGCCGCTTATAAGATCCGTGGCTCTAAGGCT
CGACTGAATTTCCCTCATTTAATCGGCTCGAACAAATCCGAGCCGATTAGAGTGGCTCCG
CGTAGGCGTTGCCACCCGTCAGAGTCATCATTGGTAGAATATACCTCTTCAAAGAAGAGA
AAATTATAA